@prefix LoadListingRequirement: . @prefix CommandLineBinding: . @prefix xsd: . @prefix DockerRequirement: . @prefix Workflow: . @prefix InlineJavascriptRequirement: . @prefix sld: . @prefix rdfs: . @prefix CommandOutputBinding: . @prefix ns2: . @prefix ns1: . @prefix NetworkAccess: . @prefix dct: . @prefix rdf: . @prefix ScatterMethod: . @prefix cwl: . @prefix ResourceRequirement: . @prefix ExpressionTool: . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--MOLECULAR_IDENTIFIER_TAG" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--MOLECULAR_IDENTIFIER_TAG" ] ; sld:type xsd:string , sld:null . sld:type xsd:string . rdfs:comment "Read Group platform unit (eg. run barcode) Required." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "PU=" ; CommandLineBinding:separate false ] ; sld:type xsd:string . cwl:source . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-U" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-U" ] ; sld:type xsd:int , sld:null . rdfs:comment "Paired-end reads that do not have this expected orientation will be considered chimeric. Default value - [FR]. This option can be set to 'null' to clear the default value. Possible values - {FR, RF, TANDEM} This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "EXPECTED_PAIR_ORIENTATIONS=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-w" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-w" ] ; sld:type xsd:int , sld:null . cwl:in , , , , , ; cwl:out ; cwl:run . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . cwl:outputSource ; sld:type cwl:File . rdfs:comment "Do not output the summary files per-sample" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--omitPerSampleStats" ] ; sld:type xsd:boolean , sld:null . sld:type xsd:string . rdfs:comment "Read Group flow order Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "FO=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:source . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "I=" ; CommandLineBinding:separate false ] ; sld:type cwl:File . cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "QUIET=True" ] ; sld:type xsd:boolean , sld:null . cwl:source . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "VERBOSITY=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:valueFrom "${ return inputs.I.basename.replace(\".bam\", \".ismetrics.pdf\")}" . cwl:source . rdfs:comment "use fast BAM compression (implies -b)\n" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-1" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-1" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-1" ] ; sld:type xsd:boolean . cwl:in , , , , , , , , , , ; cwl:out ; cwl:run . sld:type [ sld:items cwl:File ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:prefix "--bam" ] ; cwl:secondaryFiles [] ; sld:type cwl:File , xsd:string . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--REMOVE_DUPLICATES" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--REMOVE_DUPLICATES" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "Compression level to use for writing BAM files (0 - 9, higher is more compressed)" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--bam_compression" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; sld:type cwl:File . rdfs:comment "Instructs Cutadapt to use ASCII+64 quality scores as Phred scores (Illumina 1.5 encoding) for quality trimming." ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:prefix "--phred64" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "skip mate rescue" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-S" ] ; sld:type xsd:boolean , sld:null . cwl:valueFrom "${ return inputs.I.basename.replace(\".bam\", \".hstmetrics\")}" . cwl:in ; cwl:out ; cwl:run . cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "QUIET=True" ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "QUIET=True" ] ; sld:type xsd:boolean , sld:null . sld:type xsd:string . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-P" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-P" ] ; sld:type xsd:boolean , sld:null . cwl:outputSource ; sld:type cwl:File . cwl:source . cwl:inputBinding [ CommandLineBinding:prefix "--reference" ] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; sld:type cwl:File . cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; sld:type cwl:File . cwl:source . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-r" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-r" ] ; sld:type xsd:float , sld:null . sld:type [ sld:items xsd:string ; sld:type sld:array ] ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "Selecting this option for non-directional RRBS libraries will screen quality-trimmed sequences for 'CAA' or 'CGA' at the start of the read and, if found, removes the first two basepairs. Like with the option '--rrbs' this avoids using cytosine positions that were filled-in during the end-repair step. '--non_directional' requires '--rrbs' to be specified as well." ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:prefix "--non_directional" ] ; sld:type xsd:boolean , sld:null . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "VERBOSITY=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "Input array containing files to be merged" ; cwl:inputBinding [ CommandLineBinding:position 2 ] ; cwl:inputBinding [ CommandLineBinding:position 2 ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . rdfs:comment "File to write the output to. Required." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "O=" ; CommandLineBinding:separate false ] ; sld:type xsd:string . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . rdfs:comment "Whether the SAM or BAM file consists of bisulfite sequenced reads. Default value - false. This option can be set to 'null' to clear the default value. Possible values - {true, false}" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "IS_BISULFITE_SEQUENCED=True" ] ; sld:type xsd:boolean , sld:null . cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "QUIET=True" ] ; sld:type xsd:boolean , sld:null . cwl:source . cwl:source . cwl:source . cwl:source . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . a cwl:CommandLineTool ; rdfs:comment "None\n" ; ns1:original_cwlVersion "v1.0" ; cwl:baseCommand ( "/usr/bin/trim_galore" ) ; cwl:cwlVersion ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:inputs , , , , , , , , , , , , , , , , , , , , , , , ; cwl:outputs , , , ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-trimgalore:0.2.5.mod" ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ; InlineJavascriptRequirement:expressionLib "var getBaseName = function(inputFile) { return inputFile.basename; };" ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 3 ; ResourceRequirement:ramMin 12000 ] . rdfs:comment "Ignore sites consisting only of deletions" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--ignoreDeletionSites" ] ; sld:type xsd:boolean , sld:null . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.paired && inputs.fastq2)\n return getBaseName(inputs.fastq2).replace(\".fastq.gz\", \"_cl.fastq.gz\");\n return null;\n}\n" ] ; sld:type cwl:File . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.M)\n return inputs.M;\n return null;\n}\n" ] ; sld:type cwl:File . rdfs:comment "Generate mean, sd and plots by trimming the data down to MEDIAN + DEVIATIONS*MEDIAN_ABSOLUTE_DEVIATION. This is done because insert size data typically includes enough anomalous values from chimeras and other artifacts to make the mean and sd grossly misleading regarding the real distribution. Default value - 10.0. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "DEVIATIONS=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . sld:type cwl:File ; sld:type [ sld:items [ sld:items cwl:File ; sld:type sld:array ] ; sld:type sld:array ] . rdfs:comment "first query file consists of interleaved paired-end sequences" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-p" ] ; sld:type xsd:string , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-m" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-m" ] ; sld:type xsd:int , sld:null . a cwl:CommandLineTool ; rdfs:comment "Prints alignments in the specified input alignment file.\n\nWith no options or regions specified, prints all alignments in the specified input alignment file (in SAM, BAM, or CRAM format) to standard output in SAM format (with no header).\n\nYou may specify one or more space-separated region specifications after the input filename to restrict output to only those alignments which overlap the specified region(s). Use of region specifications requires a coordinate-sorted and indexed input file (in BAM or CRAM format).\n\nThe -b, -C, -1, -u, -h, -H, and -c options change the output format from the default of headerless SAM, and the -o and -U options set the output file name(s).\n\nThe -t and -T options provide additional reference data. One of these two options is required when SAM input does not contain @SQ headers, and the -T option is required whenever writing CRAM output.\n\nThe -L, -r, -R, -q, -l, -m, -f, and -F options filter the alignments that will be included in the output to only those alignments that match certain criteria.\n\nThe -x, -B, and -s options modify the data which is contained in each alignment.\n\nFinally, the -@ option can be used to allocate additional threads to be used for compression, and the -? option requests a long help message.\n\nUsage: samtools view [options] in.bam|in.sam|in.cram [region...]\n\nRegions can be specified as: RNAME[:STARTPOS[-ENDPOS]] and all position coordinates are 1-based.\n\nImportant note: when multiple regions are given, some alignments may be output multiple times if they overlap more than one of the specified regions.\n\nExamples of region specifications:\n\n`chr1'\nOutput all alignments mapped to the reference sequence named `chr1' (i.e. @SQ SN:chr1) .\n\n`chr2:1000000'\nThe region on chr2 beginning at base position 1,000,000 and ending at the end of the chromosome.\n\n`chr3:1000-2000'\nThe 1001bp region on chr3 beginning at base position 1,000 and ending at base position 2,000 (including both end positions).\n\nOPTIONS:\n\n-b\nOutput in the BAM format.\n\n-C\nOutput in the CRAM format (requires -T).\n\n-1\nEnable fast BAM compression (implies -b).\n\n-u\nOutput uncompressed BAM. This option saves time spent on compression/decompression and is thus preferred when the output is piped to another samtools command.\n\n-h\nInclude the header in the output.\n\n-H\nOutput the header only.\n\n-c\nInstead of printing the alignments, only count them and print the total number. All filter options, such as -f, -F, and -q, are taken into account.\n\n-?\nOutput long help and exit immediately.\n\n-o FILE\nOutput to FILE [stdout].\n\n-U FILE\nWrite alignments that are not selected by the various filter options to FILE. When this option is used, all alignments (or all alignments intersecting the regions specified) are written to either the output file or this file, but never both.\n\n-t FILE\nA tab-delimited FILE. Each line must contain the reference name in the first column and the length of the reference in the second column, with one line for each distinct reference. Any additional fields beyond the second column are ignored. This file also defines the order of the reference sequences in sorting. If you run: `samtools faidx ', the resulting index file .fai can be used as this FILE.\n\n-T FILE\nA FASTA format reference FILE, optionally compressed by bgzip and ideally indexed by samtools faidx. If an index is not present, one will be generated for you.\n\n-L FILE\nOnly output alignments overlapping the input BED FILE [null].\n\n-r STR\nOnly output alignments in read group STR [null].\n\n-R FILE\nOutput alignments in read groups listed in FILE [null].\n\n-q INT\nSkip alignments with MAPQ smaller than INT [0].\n\n-l STR\nOnly output alignments in library STR [null].\n\n-m INT\nOnly output alignments with number of CIGAR bases consuming query sequence ��� INT [0]\n\n-f INT\nOnly output alignments with all bits set in INT present in the FLAG field. INT can be specified in hex by beginning with `0x' (i.e. /^0x[0-9A-F]+/) or in octal by beginning with `0' (i.e. /^0[0-7]+/) [0].\n\n-F INT\nDo not output alignments with any bits set in INT present in the FLAG field. INT can be specified in hex by beginning with `0x' (i.e. /^0x[0-9A-F]+/) or in octal by beginning with `0' (i.e. /^0[0-7]+/) [0].\n\n-x STR\nRead tag to exclude from output (repeatable) [null]\n\n-B\nCollapse the backward CIGAR operation.\n\n-s FLOAT\nInteger part is used to seed the random number generator [0]. Part after the decimal point sets the fraction of templates/pairs to subsample [no subsampling].\n\n-@ INT\nNumber of BAM compression threads to use in addition to main thread [0].\n\n-S\nIgnored for compatibility with previous samtools versions. Previously this option was required if input was in SAM format, but now the correct format is automatically detected by examining the first few characters of input.\n" ; ns1:original_cwlVersion "v1.0" ; cwl:arguments ( [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-o" ; cwl:valueFrom "$(inputs.input.basename.replace('sam', 'bam'))" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--threads" ; cwl:valueFrom "$(runtime.cores)" ] ) ; cwl:arguments ( [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-o" ; cwl:valueFrom "$(inputs.input.basename.replace('sam', 'bam'))" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--threads" ; cwl:valueFrom "$(runtime.cores)" ] ) ; cwl:arguments ( [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-o" ; cwl:valueFrom "$(inputs.input.basename.replace('sam', 'bam'))" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--threads" ; cwl:valueFrom "$(runtime.cores)" ] ) ; cwl:baseCommand ( "/usr/bin/samtools" "view" ) ; cwl:baseCommand ( "/usr/bin/samtools" "view" ) ; cwl:baseCommand ( "/usr/bin/samtools" "view" ) ; cwl:cwlVersion ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:inputs , , , , , , , , , , , , , , , , , , , , , , , , , ; cwl:outputs ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-samtools:1.3.1" ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 6 ; ResourceRequirement:ramMin 32000 ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 6 ; ResourceRequirement:ramMin 32000 ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 6 ; ResourceRequirement:ramMin 32000 ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-samtools:1.3.1" ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-samtools:1.3.1" ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] . rdfs:comment "File to write the output to. Required." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "O=" ; CommandLineBinding:separate false ] ; sld:type xsd:string . rdfs:comment "Amount of padding (in bp) to add to each interval" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--interval_padding" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:in , , , , , ; cwl:out ; cwl:run . a cwl:CommandLineTool ; rdfs:comment "None\n" ; ns1:original_cwlVersion "v1.0" ; cwl:baseCommand ( "python" "/usr/bin/conpair/scripts/run_gatk_pileup_for_sample.py" ) ; cwl:cwlVersion ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:inputs , , , , , , ; cwl:outputs ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-conpair:0.3.3" ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 3 ; ResourceRequirement:ramMin 16000 ] . rdfs:comment "Compress the output file with gzip. If the input files are gzip-compressed the output files will be automatically gzip compressed as well." ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:prefix "--gzip" ] ; sld:type xsd:boolean , sld:null . sld:type [ sld:items cwl:File ; sld:type sld:array ] . sld:type xsd:string . sld:type xsd:string . rdfs:comment "Pedigree string for samples" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--pedigreeString" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.O)\n return inputs.O;\n return null;\n}\n" ] ; sld:type cwl:File . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "VERBOSITY=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "VERBOSITY=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:source . cwl:source . a cwl:CommandLineTool ; rdfs:comment "split files into chunks based on filesize\n" ; ns1:original_cwlVersion "v1.0" ; cwl:baseCommand ( "cmo_split_reads" ) ; cwl:cwlVersion ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:inputs , , ; cwl:outputs , ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-cmo-utils:1.9.15" ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 3 ; ResourceRequirement:ramMin 24000 ] . sld:type [ sld:items cwl:File ; sld:type sld:array ] . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . cwl:outputSource ; sld:type cwl:File . rdfs:comment "Optional sort order to output in. If not supplied OUTPUT is in the same order as INPUT. Default value - null. Possible values - {unsorted, queryname, coordinate, duplicate, unknown}" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "SO=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "INT minimum seed length [19]" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-k" ] ; sld:type xsd:string , sld:null . cwl:source . cwl:inputBinding [ CommandLineBinding:itemSeparator "," ; CommandLineBinding:position 0 ; CommandLineBinding:prefix "-h" ] ; cwl:inputBinding [ CommandLineBinding:itemSeparator "," ; CommandLineBinding:position 0 ; CommandLineBinding:prefix "-h" ] ; sld:type sld:null ; sld:type [ sld:items xsd:int ; sld:type sld:array ] ; sld:type [ sld:items xsd:int ; sld:type sld:array ] . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.O)\n return inputs.O.replace(/^.*[\\\\\\/]/, '').replace(/\\.[^/.]+$/, '').replace(/\\.bam/,'') + \".bai\";\n return null;\n}\n" ] ; sld:type cwl:File , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--reference" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--reference" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--reference" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--reference" ] ; sld:type cwl:File , sld:null . cwl:default "SILENT" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "VALIDATION_STRINGENCY=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:default "fastqs" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--output-dir" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--output-dir" ] ; sld:type xsd:string . rdfs:comment "Type of BAQ calculation to apply in the engine (OFF| CALCULATE_AS_NECESSARY| RECALCULATE)" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--baq" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "[region ...]\n" ; cwl:inputBinding [ CommandLineBinding:position 5 ] ; cwl:inputBinding [ CommandLineBinding:position 5 ] ; cwl:inputBinding [ CommandLineBinding:position 5 ] ; sld:type xsd:string , sld:null . sld:type xsd:string . cwl:outputSource ; sld:type cwl:File . rdfs:comment "Total number of BAM file handles to keep open simultaneously" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--num_bam_file_handles" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "Set merging approach to use for combining interval inputs (UNION|INTERSECTION)" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--interval_set_rule" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "Run reporting mode (NO_ET|AWS| STDOUT)" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--phone_home" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "Sample Size used for Theoretical Het Sensitivity sampling. Default is 10000. Default value - 10000. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "SAMPLE_SIZE=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "SAMPLE_SIZE=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-A" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-A" ] ; sld:type xsd:int , sld:null . cwl:in , , ; cwl:out , ; cwl:run ; cwl:scatter ( ) ; cwl:scatterMethod ScatterMethod:dotproduct . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-c" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-c" ] ; sld:type xsd:int , sld:null . sld:type xsd:string . rdfs:comment "One or more genomic intervals over which to operate" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--intervals" ] ; sld:type cwl:File , xsd:string . cwl:source . cwl:outputSource ; sld:type cwl:File . cwl:inputBinding [ CommandLineBinding:position 2 ] ; cwl:inputBinding [ CommandLineBinding:position 2 ] ; sld:type sld:null ; sld:type [ cwl:inputBinding [ CommandLineBinding:prefix "LEVEL=" ; CommandLineBinding:separate false ] ; sld:items xsd:string ; sld:type sld:array ] ; sld:type [ cwl:inputBinding [ CommandLineBinding:prefix "LEVEL=" ; CommandLineBinding:separate false ] ; sld:items xsd:string ; sld:type sld:array ] . cwl:outputSource ; sld:type cwl:File . cwl:outputSource ; sld:type cwl:File . rdfs:comment "Filters to apply to reads before analysis" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--read_filter" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:valueFrom "${ return \"10\"; }" . sld:type [ sld:fields , , , , , , , , , , , , , , ; sld:type sld:record ] ; sld:type [ sld:fields , , , , , , , , , , , , , , ; sld:type sld:record ] . rdfs:label "GATK MarkDuplicates" ; cwl:in ; cwl:out , ; cwl:run . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MAX_RECORDS_IN_RAM=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "Explicitly sets the Histogram width, overriding automatic truncation of Histogram tail. Also, when calculating mean and standard deviation, only bins <= Histogram_WIDTH will be included. Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "HISTOGRAM_WIDTH=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "Add base counts to per-locus output" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--printBaseCounts" ] ; sld:type xsd:boolean , sld:null . cwl:source . rdfs:comment "Clear DT tag from input SAM records. Should be set to false if input SAM doesn't have this tag. Default true Default value - true. This option can be set to 'null' to clear the default value. Possible values - {true, false}" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CLEAR_DT=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:source . rdfs:comment "Read Group ID Default value - 1. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "ID=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . sld:type cwl:File . rdfs:comment "output all alignments for SE or unpaired PE" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-a" ] ; sld:type xsd:boolean , sld:null . cwl:source . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.CHART)\n return inputs.CHART;\n return null;\n}\n" ] ; sld:type cwl:File . rdfs:comment "Value of PN tag of PG record to be created. Default value - MarkDuplicates. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "PROGRAM_GROUP_NAME=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "REFERENCE_SEQUENCE=" ; CommandLineBinding:separate false ] ; sld:type cwl:File . rdfs:comment "uncompressed BAM output (implies -b)\n" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-u" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-u" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-u" ] ; sld:type xsd:boolean . cwl:source . cwl:linkMerge "merge_flattened" ; cwl:source , . cwl:in , , , ; cwl:out , , ; cwl:run . rdfs:comment "Keep program records in the SAM header" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--keep_program_records" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "Input covariates table file for on-the-fly base quality score recalibration" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--BQSR" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:in ; cwl:out , , , , , , , , , , , , , , , ; cwl:run . rdfs:comment "only include reads in library STR [null]\n" ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-l" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-l" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-l" ] ; sld:type xsd:string , sld:null . rdfs:comment "Input BAM file" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--INPUT" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--INPUT" ] ; sld:type cwl:File . cwl:source . sld:type xsd:string . rdfs:comment "Rename sample IDs on-the-fly at runtime using the provided mapping file" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--sample_rename_mapping_file" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--TAGGING_POLICY" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--TAGGING_POLICY" ] ; sld:type xsd:string , sld:null . cwl:source . a cwl:CommandLineTool ; rdfs:label "GATK MarkDuplicates" ; ns1:original_cwlVersion "v1.0" ; cwl:arguments ( [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--OUTPUT" ; cwl:valueFrom "$(inputs.input.basename.replace('md.bam', 'bam'))" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--METRICS_FILE" ; cwl:valueFrom "$(inputs.input.basename.replace('bam', 'md.metrics'))" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--TMP_DIR" ; cwl:valueFrom "." ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--ASSUME_SORT_ORDER" ; cwl:valueFrom "coordinate" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--CREATE_INDEX" ; cwl:valueFrom "true" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--MAX_RECORDS_IN_RAM" ; cwl:valueFrom "50000" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--java-options" ; cwl:valueFrom "-Xms$(Math.round(parseInt(runtime.ram)/1910))G -Xmx$(Math.floor(parseInt(runtime.ram)/1048) - 1)G" ] ) ; cwl:arguments ( [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--OUTPUT" ; cwl:valueFrom "$(inputs.input.basename.replace('md.bam', 'bam'))" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--METRICS_FILE" ; cwl:valueFrom "$(inputs.input.basename.replace('bam', 'md.metrics'))" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--TMP_DIR" ; cwl:valueFrom "." ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--ASSUME_SORT_ORDER" ; cwl:valueFrom "coordinate" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--CREATE_INDEX" ; cwl:valueFrom "true" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--MAX_RECORDS_IN_RAM" ; cwl:valueFrom "50000" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--java-options" ; cwl:valueFrom "-Xms$(Math.round(parseInt(runtime.ram)/1910))G -Xmx$(Math.floor(parseInt(runtime.ram)/1048) - 1)G" ] ) ; cwl:baseCommand ( "gatk" "MarkDuplicates" ) ; cwl:baseCommand ( "gatk" "MarkDuplicates" ) ; cwl:cwlVersion ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:inputs , , , , , , , , , , , , , , , , , , , , , , , , , ; cwl:outputs , ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "broadinstitute/gatk:4.1.0.0" ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 3 ; ResourceRequirement:ramMin 42000 ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "broadinstitute/gatk:4.1.0.0" ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 3 ; ResourceRequirement:ramMin 42000 ] . cwl:source . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . rdfs:comment "Stop after processing N reads, mainly for debugging. Default value - 0. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "STOP_AFTER=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--ASSUME_SORT_ORDER" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--ASSUME_SORT_ORDER" ] ; sld:type xsd:string , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-Y" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-Y" ] ; sld:type xsd:boolean , sld:null . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.paired && inputs.fastq2)\n return getBaseName(inputs.fastq2).replace(\".fastq.gz\", \"_cl.stats\");\n return null;\n}" ] ; sld:type cwl:File . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "VERBOSITY=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:outputBinding [ CommandOutputBinding:glob "$(inputs.input.basename.replace('sam', 'bam'))" ] ; cwl:outputBinding [ CommandOutputBinding:glob "$(inputs.input.basename.replace('sam', 'bam'))" ] ; cwl:outputBinding [ CommandOutputBinding:glob "$(inputs.input.basename.replace('sam', 'bam'))" ] ; sld:type cwl:File . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . a cwl:ExpressionTool ; ExpressionTool:expression "${ var sample_object = {}; for(var key in inputs.sample){ sample_object[key] = inputs.sample[key] } sample_object['zPU'] = []; if(sample_object['zR1'].length != 0 && sample_object['zR2'].length != 0 ){ sample_object['zPU'] = [sample_object['PU']]; } if(sample_object['zBam'].length != 0){ sample_object['zPU'] = [sample_object['PU']]; } return sample_object; }" ; cwl:inputs ; cwl:outputs , , , , , , , , , , , , , , , . rdfs:comment "Unpaired single-end read length cutoff needed for read 1 to be written to '.unpaired_1.fq' output file. These reads may be mapped in single-end mode. Default - 35 bp." ; cwl:inputBinding [ CommandLineBinding:prefix "--length_1" ] ; sld:type xsd:string , sld:null . cwl:source . cwl:inputBinding [ CommandLineBinding:prefix "--outfile" ] ; sld:type xsd:string . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-O" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-O" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-O" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-O" ] ; sld:type xsd:string , sld:null . rdfs:comment "When generating the Histogram, discard any data categories (out of FR, TANDEM, RF) that have fewer than this percentage of overall reads. (Range - 0 to 1). Default value - 0.05. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MINIMUM_PCT=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "if we are to clip overlapping reads, false otherwise. Default value - true. This option can be set to 'null' to clear the default value. Possible values - {true, false}" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CLIP_OVERLAPPING_READS=True" ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CLIP_OVERLAPPING_READS=True" ] ; sld:type xsd:boolean , sld:null . cwl:valueFrom "${ return inputs.I.basename.replace(\".bam\", \".rg.bam\") }" . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-T" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-T" ] ; sld:type xsd:int , sld:null . rdfs:comment "print only the count of matching records\n" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-c" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-c" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-c" ] ; sld:type xsd:boolean . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-v" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-v" ] ; sld:type xsd:int , sld:null . cwl:source . rdfs:comment "Set the logging location" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--log_to_file" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "Whether the SAM or BAM file consists of bisulfite sequenced reads. Default value - false. This option can be set to 'null' to clear the default value. Possible values - {true, false}" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "IS_BISULFITE_SEQUENCED=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:source . cwl:source . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP" ] ; sld:type xsd:int , sld:null . rdfs:comment "The text file to write summary metrics to. Required." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "SUMMARY_OUTPUT=" ; CommandLineBinding:separate false ] ; sld:type xsd:string . sld:type xsd:string . cwl:in , , , , , ; cwl:out ; cwl:run . rdfs:comment "File to write insert size Histogram chart to. Required." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "HISTOGRAM_FILE=" ; CommandLineBinding:separate false ] ; sld:type xsd:string . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.out)\n return inputs.out;\n return null;\n}\n" ] ; sld:type cwl:File . rdfs:comment "An output file created by the walker. Will overwrite contents if file exists" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--out" ] ; sld:type xsd:string ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . sld:type [ sld:items cwl:File ; sld:type sld:array ] . rdfs:comment "Read two barcode SAM tag (ex. BX for 10X Genomics) Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "READ_TWO_BARCODE_TAG=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:in , ; cwl:out , ; cwl:run . sld:type cwl:File . cwl:source . rdfs:comment "STR read group header line such as '@RG\\tID -foo\\tSM -bar' [null]" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-R" ] ; sld:type xsd:string , sld:null . cwl:inputBinding [ CommandLineBinding:itemSeparator "," ; CommandLineBinding:position 0 ; CommandLineBinding:prefix "-O" ] ; cwl:inputBinding [ CommandLineBinding:itemSeparator "," ; CommandLineBinding:position 0 ; CommandLineBinding:prefix "-O" ] ; sld:type sld:null ; sld:type [ sld:items xsd:int ; sld:type sld:array ] ; sld:type [ sld:items xsd:int ; sld:type sld:array ] . rdfs:comment "INT number of threads [1]" ; cwl:default "6" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-t" ] ; sld:type xsd:string , sld:null . rdfs:comment "Parameter to pass to the VCF/BCF IndexCreator" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--variant_index_parameter" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:position 2 ] ; sld:type cwl:File , xsd:string . cwl:source . rdfs:comment "if a read has no stored bases (i.e. a '*'), filter out the read instead of blowing up." ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--filter_bases_not_stored" ] ; sld:type xsd:boolean , sld:null . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . sld:type cwl:Directory . rdfs:comment "If specified all output will be written to this directory instead of the current directory." ; cwl:inputBinding [ CommandLineBinding:prefix "--output_dir" ] ; sld:type xsd:string , sld:null . rdfs:comment "Output marked duplicate bam" ; cwl:outputBinding [ CommandOutputBinding:glob "$(inputs.input.basename.replace('md.bam', 'bam'))" ] ; cwl:outputBinding [ CommandOutputBinding:glob "$(inputs.input.basename.replace('md.bam', 'bam'))" ] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; sld:type cwl:File . cwl:default "SILENT" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "VALIDATION_STRINGENCY=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "VALIDATION_STRINGENCY=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . rdfs:comment "Minimum mapping quality of reads to count towards depth" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--minMappingQuality" ] ; sld:type xsd:string . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--BARCODE_TAG" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--BARCODE_TAG" ] ; sld:type xsd:string , sld:null . cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CREATE_INDEX=True" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "Include sites where the reference is N" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--includeRefNSites" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "number of BAM compression threads [0]\n" ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-@" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-@" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-@" ] ; sld:type xsd:int , sld:null . cwl:valueFrom "${ return true; }" . rdfs:comment "Don't recalibrate bases with quality scores less than this threshold (with -BQSR)" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--preserve_qscores_less_than" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:source . cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CREATE_MD5_FILE=True" ] ; sld:type xsd:boolean , sld:null . cwl:in , ; cwl:out ; cwl:run . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.paired && inputs.fastq1)\n return getBaseName(inputs.fastq1).replace(\".fastq.gz\", \"_cl.fastq.gz\");\n return null;\n}\n" ] ; sld:type cwl:File . rdfs:comment "Minimum base quality for a base to contribute coverage. Default value - 20. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MINIMUM_BASE_QUALITY=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MINIMUM_BASE_QUALITY=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "mark shorter split hits as secondary (for Picard/GATK compatibility)" ; cwl:default true ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-M" ] ; sld:type xsd:boolean , sld:null . cwl:source . cwl:outputBinding [ CommandOutputBinding:glob "${\n return inputs.output_dir.concat('/*.disambiguatedSpeciesA.bam');\n}\n" ] ; sld:type cwl:File . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--OPTICAL_DUPLICATE_PIXEL_DISTANCE" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--OPTICAL_DUPLICATE_PIXEL_DISTANCE" ] ; sld:type xsd:int , sld:null . sld:type cwl:File ; sld:type [ sld:items [ sld:items cwl:File ; sld:type sld:array ] ; sld:type sld:array ] . sld:type xsd:string . rdfs:comment "Discard reads that became shorter than length INT because of either quality or adapter trimming. A value of '0' effectively disables this behaviour. Default - 20 bp. For paired-end files, both reads of a read-pair need to be longer than bp to be printed out to validated paired-end files (see option --paired). If only one read became too short there is the possibility of keeping such unpaired single-end reads (see --retain_unpaired). Default pair-cutoff - 20 bp." ; cwl:default "25" ; cwl:inputBinding [ CommandLineBinding:prefix "--length" ] ; sld:type xsd:string , sld:null . cwl:source . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.O)\n return inputs.O;\n return null;\n}\n" ] ; cwl:secondaryFiles [] ; sld:type cwl:File . sld:type xsd:string . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "I=" ; CommandLineBinding:separate false ] ; sld:type cwl:File . cwl:source . cwl:source . rdfs:comment "Trims 1 bp off every read from its 3' end. This may be needed for FastQ files that are to be aligned as paired-end data with Bowtie. This is because Bowtie (1) regards alignments like this - R1 ---------------------------> or this - -----------------------> R1 R2 <--------------------------- <----------------- R2 as invalid (whenever a start/end coordinate is contained within the other read)." ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:prefix "--trim1" ] ; sld:type xsd:boolean , sld:null . sld:type [ sld:items xsd:string ; sld:type sld:array ] ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "If specified no report file will be generated." ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:prefix "--no_report_file" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "only include reads with none of the bits set in INT set in FLAG [0]\n" ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-F" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-F" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-F" ] ; sld:type xsd:int , sld:null . sld:type xsd:string . cwl:inputBinding [ CommandLineBinding:itemSeparator "," ; CommandLineBinding:position 0 ; CommandLineBinding:prefix "-E" ] ; cwl:inputBinding [ CommandLineBinding:itemSeparator "," ; CommandLineBinding:position 0 ; CommandLineBinding:prefix "-E" ] ; sld:type sld:null ; sld:type [ sld:items xsd:int ; sld:type sld:array ] ; sld:type [ sld:items xsd:int ; sld:type sld:array ] . rdfs:comment "Number of data threads to allocate to this analysis" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--num_threads" ] ; sld:type xsd:string , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-O" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-O" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-O" ] ; sld:type xsd:string , sld:null . rdfs:comment "Read Group key sequence Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "KS=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "Maximum mapping quality of reads to count towards" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--maxMappingQuality" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "I=" ; CommandLineBinding:separate false ] ; sld:type cwl:File . cwl:valueFrom "${ return inputs.bam.basename.replace(\".bam\", \".pileup\"); }" . sld:type xsd:string . cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "QUIET=True" ] ; sld:type xsd:boolean , sld:null . cwl:inputBinding [ CommandLineBinding:position 2 ] ; sld:type sld:null ; sld:type [ cwl:inputBinding [ CommandLineBinding:prefix "LEVEL=" ; CommandLineBinding:separate false ] ; sld:items xsd:string ; sld:type sld:array ] . cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "QUIET=True" ] ; sld:type xsd:boolean , sld:null . cwl:in ; cwl:out ; cwl:run . cwl:source . a cwl:ExpressionTool ; ns1:original_cwlVersion "v1.0" ; ExpressionTool:expression "${ if (inputs.directory_list.length != 0) { return {'output_directory':inputs.directory_list[0]}; } else { return { 'output_directory': {'class': 'Directory','basename': 'empty','listing': []} }}; }" ; cwl:cwlVersion ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:inputs ; cwl:outputs ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] . cwl:valueFrom "${ return inputs.I.basename.replace(\".bam\", \".gcbiasmetrics\") }" . cwl:valueFrom "${ return inputs.I[0].basename.replace(/\\.chunk\\d\\d\\d\\.rg\\.bam/, \".rg.md_metrics\") }" . rdfs:comment "If not null, assume that the input file has this order even if the header says otherwise. Default value - null. Possible values - {unsorted, queryname, coordinate, duplicate, unknown} Cannot be used in conjuction with option(s) ASSUME_SORTED (AS)" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "ASSUME_SORT_ORDER=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "append FASTA/FASTQ comment to SAM output" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-C" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "Always output all the records in VCF FORMAT fields, even if some are missing" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--never_trim_vcf_format_field" ] ; sld:type xsd:boolean , sld:null . cwl:valueFrom "${ return inputs.prefix + \"_human\"; }" . rdfs:comment "If a read appears in a duplicate set, add two tags. The first tag, DUPLICATE_SET_SIZE_TAG (DS), indicates the size of the duplicate set. The smallest possible DS value is 2 which occurs when two reads map to the same portion of the reference only one of which is marked as duplicate. The second tag, DUPLICATE_SET_INDEX_TAG (DI), represents a unique identifier for the duplicate set to which the record belongs. This identifier is the index-in-file of the representative read that was selected out of the duplicate set. Default value - false. This option can be set to 'null' to clear the default value. Possible values - {true, false}" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "TAG_DUPLICATE_SET_MEMBERS=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:outputSource ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . rdfs:comment "Partition type for depth of coverage" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--partitionType" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "Stop after processing N reads, mainly for debugging. Default value - 0. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "STOP_AFTER=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "Stop execution cleanly as soon as maxRuntime has been reached" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--maxRuntime" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:linkMerge "merge_flattened" ; cwl:source , . cwl:in , , , ; cwl:out , , , ; cwl:run . cwl:valueFrom "${ return [\"24g\"]; }" . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MAX_RECORDS_IN_RAM=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . a cwl:CommandLineTool ; rdfs:comment "None\n" ; ns1:original_cwlVersion "v1.0" ; cwl:arguments ( [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-jar" ; CommandLineBinding:shellQuote false ; cwl:valueFrom "/usr/bin/gatk.jar" ] [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-T" ; CommandLineBinding:shellQuote false ; cwl:valueFrom "DepthOfCoverage" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Xms$(Math.round(parseInt(runtime.ram)/1910))G" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Xmx$(Math.floor(parseInt(runtime.ram)/1048) - 1)G" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-XX:-UseGCOverheadLimit" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Djava.io.tmpdir=$(runtime.tmpdir)" ] ) ; cwl:baseCommand ( "java" ) ; cwl:cwlVersion ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:inputs , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , ; cwl:outputs ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-gatk:3.3-0" ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 3 ; ResourceRequirement:ramMin 16000 ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] . rdfs:comment "Use the base quality scores from the OQ tag" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--useOriginalQualities" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "Number of CPU threads to allocate per data thread" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--num_cpu_threads_per_data_thread" ] ; sld:type xsd:string , sld:null . rdfs:comment "Global Qscore Bayesian prior to use for BQSR" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--globalQScorePrior" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "if a read has mismatching number of bases and base qualities, filter out the read instead of blowing up." ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--filter_mismatching_base_and_quals" ] ; sld:type xsd:boolean , sld:null . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . sld:type [ sld:items xsd:string ; sld:type sld:array ] . sld:type xsd:string . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--sample-id" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--sample-id" ] ; sld:type xsd:string . rdfs:comment "Read Group sequencing center name Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CN=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:source . cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CREATE_MD5_FILE=True" ] ; sld:type xsd:boolean , sld:null . cwl:source . cwl:linkMerge "merge_flattened" ; cwl:source , . rdfs:comment "Set the minimum level of logging" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--logging_level" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:source . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "COMPRESSION_LEVEL=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "VALIDATION_STRINGENCY=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "Instructs Cutadapt to use ASCII+33 quality scores as Phred scores (Sanger/Illumina 1.9+ encoding) for quality trimming. Default - ON." ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:prefix "--phred33" ] ; sld:type xsd:boolean , sld:null . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "VALIDATION_STRINGENCY=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:source . cwl:source . rdfs:comment "If specified any output to STDOUT or STDERR will be suppressed.RRBS-specific options (MspI digested material) -" ; cwl:default true ; cwl:inputBinding [ CommandLineBinding:prefix "--suppress_warn" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "Interval merging rule for abutting intervals (ALL| OVERLAPPING_ONLY)" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--interval_merging" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "Set maximum memory per thread; suffix K/M/G recognized [768M]\n" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-m" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-m" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-m" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-m" ] ; sld:type xsd:string , sld:null . rdfs:comment "The PDF file to render the chart to. Required." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CHART_OUTPUT=" ; CommandLineBinding:separate false ] ; sld:type xsd:string . cwl:outputSource ; sld:type cwl:File . rdfs:comment "One or more genomic intervals to exclude from processing" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--excludeIntervals" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:valueFrom "${ return inputs.prefix + \"_disambiguated\"; }" . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.paired && inputs.fastq1)\n return getBaseName(inputs.fastq1).replace(\".fastq.gz\", \"_cl.stats\");\n return null;\n}\n" ] ; sld:type cwl:File . sld:type xsd:string . rdfs:comment "Type of IndexCreator to use for VCF/BCF indices (DYNAMIC_SEEK| DYNAMIC_SIZE|LINEAR|INTERVAL)" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--variant_index_type" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . sld:type xsd:string . cwl:outputSource ; sld:type cwl:File . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . cwl:outputBinding [ CommandOutputBinding:glob "$(inputs.reads[0].basename.replace('fastq.gz', 'sam'))" ] ; cwl:outputBinding [ CommandOutputBinding:glob "$(inputs.reads[0].basename.replace('fastq.gz', 'sam'))" ] ; sld:type cwl:File . a cwl:CommandLineTool ; ns1:original_cwlVersion "v1.0" ; cwl:baseCommand ( "ngs_disambiguate" ) ; cwl:cwlVersion ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:inputs , , , , , ; cwl:outputs , , ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/disambiguate:1.0.0" ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 6 ; ResourceRequirement:ramMin 32000 ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] . rdfs:comment "Print the bin values and exit immediately" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--printBinEndpointsAndExit" ] ; sld:type xsd:boolean , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-t" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-t" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-t" ] ; sld:type cwl:File , sld:null . rdfs:comment "This number, plus the maximum RAM available to the JVM, determine the memory footprint used by some of the sorting collections. If you are running out of memory, try reducing this number. Default value - 0.25. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "SORTING_COLLECTION_SIZE_RATIO=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "Validation strictness for pedigree information (STRICT| SILENT)" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--pedigreeValidationType" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "reference sequence FASTA FILE [null]\n" ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-T" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-T" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-T" ] ; sld:type cwl:File , sld:null . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--DUPLEX_UMI" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--DUPLEX_UMI" ] ; sld:type xsd:boolean , sld:null . cwl:inputBinding [ CommandLineBinding:position 2 ] ; sld:type sld:null ; sld:type [ cwl:inputBinding [ CommandLineBinding:prefix "LEVEL=" ; CommandLineBinding:separate false ] ; sld:items xsd:string ; sld:type sld:array ] . cwl:valueFrom "${ return inputs.prefix + \"_mouse\"; }" . cwl:source . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "COMPRESSION_LEVEL=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:valueFrom "${return [\"null\", \"SAMPLE\"]}" . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-S" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-S" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "The format of the output file" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--outputFormat" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "An interval list file that contains the locations of the baits used. Default value - null. This option must be specified at least 1 times." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "BAIT_INTERVALS=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "BAIT_INTERVALS=" ; CommandLineBinding:separate false ] ; sld:type cwl:File . rdfs:comment "Minimum quality of bases to count towards depth" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--minBaseQuality" ] ; sld:type xsd:string . cwl:outputSource ; sld:type xsd:string . sld:type cwl:File . rdfs:comment "Read Group library Required." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "LB=" ; CommandLineBinding:separate false ] ; sld:type xsd:string . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--COMMENT" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--COMMENT" ] ; sld:type xsd:string , sld:null . cwl:outputBinding [ CommandOutputBinding:glob "${\n return inputs.output_dir.concat('/*_summary.txt');\n}\n" ; CommandOutputBinding:outputEval "${\n self[0].basename=inputs.prefix+\"_disambiguate_summary.txt\";\n return self;\n}\n" ] ; sld:type cwl:File . rdfs:comment "set up java -Xmx parameter" ; cwl:inputBinding [ CommandLineBinding:prefix "--xmx_java" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:in , , , , , , , , , , , , ; cwl:out , , ; cwl:run ; cwl:scatter ( ) ; cwl:scatterMethod ScatterMethod:dotproduct . cwl:outputSource ; sld:type cwl:File . cwl:source . rdfs:comment "If true (default), then the sort order in the header file will be ignored. Default value - true. This option can be set to 'null' to clear the default value. Possible values - {true, false}" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "ASSUME_SORTED=True" ] ; sld:type xsd:boolean , sld:null . cwl:source . cwl:in , , ; cwl:out ; cwl:run . a cwl:CommandLineTool ; rdfs:comment "None\n" ; ns1:original_cwlVersion "v1.0" ; cwl:arguments ( [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-jar" ; CommandLineBinding:shellQuote false ; cwl:valueFrom "/usr/bin/picard-tools/picard.jar" ] [ CommandLineBinding:position 1 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "CollectAlignmentSummaryMetrics" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Xms$(Math.round(parseInt(runtime.ram)/1910))G" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Xmx$(Math.floor(parseInt(runtime.ram)/1048) - 1)G" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-XX:-UseGCOverheadLimit" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Djava.io.tmpdir=$(runtime.tmpdir)" ] [ CommandLineBinding:position 2 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "TMP_DIR=$(runtime.tmpdir)" ] ) ; cwl:baseCommand ( "java" ) ; cwl:cwlVersion ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:inputs , , , , , , , , , , , , , , , , ; cwl:outputs ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-picard:2.9" ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 5 ; ResourceRequirement:ramMin 16000 ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] . rdfs:comment "Fix mis-encoded base quality scores" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--fix_misencoded_quality_scores" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "Disable printing of base insertion and deletion tags (with -BQSR)" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--disable_indel_quals" ] ; sld:type xsd:boolean , sld:null . cwl:valueFrom "${ return true; }" . cwl:valueFrom "${ return inputs.input_file.basename.replace(\".bam\", \"_FP_base_counts.txt\") }" . sld:type [ sld:items cwl:File ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "REFERENCE_SEQUENCE=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "REFERENCE_SEQUENCE=" ; CommandLineBinding:separate false ] ; sld:type cwl:File . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--MAX_FILE_HANDLES_FOR_READ_ENDS_MAP" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--MAX_FILE_HANDLES_FOR_READ_ENDS_MAP" ] ; sld:type xsd:int , sld:null . cwl:source . cwl:source . cwl:source . rdfs:comment "Include information on deletions" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--includeDeletions" ] ; sld:type xsd:boolean , sld:null . cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CREATE_INDEX=True" ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CREATE_INDEX=True" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "Pedigree files for samples" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--pedigree" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:outputSource ; sld:type xsd:string ; sld:type [ sld:items xsd:string ; sld:type sld:array ] ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:source . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-p" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-p" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "Sort by read names (i.e., the QNAME field) rather than by chromosomal coordinates." ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-n" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-n" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-n" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-n" ] ; sld:type xsd:boolean , sld:null . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . rdfs:comment "output in CRAM format\n" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "-C" ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "-C" ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "-C" ] ; sld:type xsd:boolean . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--ASSUME_SORTED" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--ASSUME_SORTED" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "only include reads with read group listed in FILE [null]\n" ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-R" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-R" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-R" ] ; sld:type cwl:File , sld:null . cwl:inputBinding [ CommandLineBinding:position 2 ] ; sld:type cwl:File , xsd:string . sld:type cwl:File . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.O)\n return inputs.O;\n return null;\n}\n" ] ; sld:type cwl:File . rdfs:comment "Determines how duplicate types are recorded in the DT optional attribute. Default value - DontTag. This option can be set to 'null' to clear the default value. Possible values - {DontTag, OpticalOnly, All}" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "TAGGING_POLICY=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "Maximum quality of bases to count towards depth" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--maxBaseQuality" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "VERBOSITY=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.output)\n return inputs.output;\n return null;\n}" ] ; sld:type cwl:File . sld:type xsd:string . rdfs:comment "Value of VN tag of PG record to be created. If not specified, the version will be detected automatically. Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "PROGRAM_GROUP_VERSION=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:default "coordinate" . cwl:in , , , , , ; cwl:out , ; cwl:run ; cwl:scatter ( ) ; cwl:scatterMethod ScatterMethod:dotproduct . cwl:inputBinding [ CommandLineBinding:prefix "--gatk" ] ; sld:type cwl:File , xsd:string , sld:null . rdfs:comment "Read Group predicted insert size Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "PI=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . sld:type xsd:string . rdfs:comment "This option performs length trimming of quality/adapter/RRBS trimmed reads for paired-end files. To pass the validation test, both sequences of a sequence pair are required to have a certain minimum length which is governed by the option --length (see above). If only one read passes this length threshold the other read can be rescued (see option --retain_unpaired). Using this option lets you discard too short read pairs without disturbing the sequence-by-sequence order of FastQ files which is required by many aligners. Trim Galore! expects paired-end files to be supplied in a pairwise fashion, e.g. file1_1.fq file1_2.fq SRR2_1.fq.gz SRR2_2.fq.gz ... ." ; cwl:default true ; cwl:inputBinding [ CommandLineBinding:prefix "--paired" ] ; sld:type xsd:boolean , sld:null . cwl:source . sld:type xsd:string . rdfs:comment "only include reads with number of CIGAR operations\nconsuming query sequence >= INT [0]\n" ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-m" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-m" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-m" ] ; sld:type xsd:int , sld:null . rdfs:comment "INT penalty for clipping [5]" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-L" ] ; sld:type xsd:string , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-M" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-M" ] ; sld:type xsd:string , sld:null . cwl:in , ; cwl:out ; cwl:run . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-k" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-k" ] ; sld:type xsd:int , sld:null . rdfs:comment "log stderr to file" ; cwl:inputBinding [ CommandLineBinding:prefix "--stderr" ] ; sld:type xsd:string , sld:null . rdfs:comment "include header in SAM output\n" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-h" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-h" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-h" ] ; sld:type xsd:boolean . sld:type xsd:string . cwl:default "/opt/common/CentOS_6-dev/picard/v2.13/picard.jar" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--picard-jar" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--picard-jar" ] ; sld:type xsd:string . cwl:outputSource ; sld:type cwl:File . rdfs:comment "log stdout to file" ; cwl:inputBinding [ CommandLineBinding:prefix "--stdout" ] ; sld:type xsd:string , sld:null . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--reference_sequence" ] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; sld:type cwl:File . rdfs:comment "Ignore warnings about base quality score encoding" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--allow_potentially_misencoded_quality_scores" ] ; sld:type xsd:boolean , sld:null . sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:position 3 ] ; cwl:inputBinding [ CommandLineBinding:position 3 ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . rdfs:comment "Reads arguments from the specified file" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--arg_file" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:outputSource ; sld:type cwl:File . cwl:valueFrom "${ return inputs.I.basename.replace(\".bam\", \".gcbias.summary\")}" . cwl:source . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--TAG_DUPLICATE_SET_MEMBERS" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--TAG_DUPLICATE_SET_MEMBERS" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "Input file containing sequence data (SAM or BAM)" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--input_file" ] ; sld:type cwl:File ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "Set compression level, from 0 (uncompressed) to 9 (best)\n" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-l" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-l" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-l" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-l" ] ; sld:type xsd:int , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--output-dir" ] ; sld:type xsd:string . sld:type cwl:File . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-D" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-D" ] ; sld:type xsd:float , sld:null . rdfs:comment "Read Group sample name Required." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "SM=" ; CommandLineBinding:separate false ] ; sld:type xsd:string . a cwl:Workflow ; ns1:original_cwlVersion "v1.0" ; Workflow:steps , , , , , , ; cwl:cwlVersion ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:inputs , , , , , , , ; cwl:outputs , , , , , , , , , ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:ScatterFeatureRequirement ] ; cwl:requirements [ a cwl:SubworkflowFeatureRequirement ] ; cwl:requirements [ a cwl:StepInputExpressionRequirement ] ; cwl:requirements [ a cwl:MultipleInputFeatureRequirement ] . sld:type xsd:string . sld:type xsd:string . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--REMOVE_SEQUENCING_DUPLICATES" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--REMOVE_SEQUENCING_DUPLICATES" ] ; sld:type xsd:boolean , sld:null . cwl:source . cwl:valueFrom "${ return [\"null\", \"SAMPLE\"];}" . rdfs:comment "only include reads with mapping quality >= INT [0]\n" ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-q" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-q" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-q" ] ; sld:type xsd:int , sld:null . rdfs:comment "collapse the backward CIGAR operation\n" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-B" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-B" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-B" ] ; sld:type xsd:boolean . cwl:outputSource ; sld:type cwl:File . a cwl:CommandLineTool ; rdfs:comment "None\n" ; ns1:original_cwlVersion "v1.0" ; cwl:arguments ( [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-jar" ; CommandLineBinding:shellQuote false ; cwl:valueFrom "/usr/bin/picard-tools/picard.jar" ] [ CommandLineBinding:position 1 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "CollectInsertSizeMetrics" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Xms$(Math.round(parseInt(runtime.ram)/1910))G" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Xmx$(Math.floor(parseInt(runtime.ram)/1048) - 1)G" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-XX:-UseGCOverheadLimit" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Djava.io.tmpdir=$(runtime.tmpdir)" ] [ CommandLineBinding:position 2 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "TMP_DIR=$(runtime.tmpdir)" ] ) ; cwl:baseCommand ( "java" ) ; cwl:cwlVersion ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:inputs , , , , , , , , , , , , , , , , ; cwl:outputs , ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 5 ; ResourceRequirement:ramMin 16000 ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-picard:2.9" ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] . cwl:source . a cwl:CommandLineTool ; rdfs:comment "bwa mem\n args set:\n -M\n -t 6\n" ; rdfs:label "run bwa mem -t 6 -M" ; ns1:original_cwlVersion "v1.0" ; cwl:baseCommand ( "/usr/bin/bwa" "mem" ) ; cwl:cwlVersion ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:inputs , , , , , , , , , , , , , , , , , , , , , , , , ; cwl:outputs ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/bwa_mem:0.7.12" ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 6 ; ResourceRequirement:ramMin 32000 ] ; cwl:stdout "$(inputs.output)" . rdfs:comment "Overlap with adapter sequence required to trim a sequence. Defaults to a very stringent setting of '1', i.e. even a single bp of overlapping sequence will be trimmed of the 3' end of any read.-e Maximum allowed error rate (no. of errors divided by the length of the matching region) (default - 0.1)" ; cwl:inputBinding [ CommandLineBinding:prefix "--stringency" ] ; sld:type xsd:string , sld:null . rdfs:comment "Target coverage threshold for downsampling to coverage" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--downsample_to_coverage" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:valueFrom "${ return \"3\"; }" . cwl:valueFrom "${ return [\"BadCigar\"];}" . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "COMPRESSION_LEVEL=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "INT penalty for a mismatch [4]" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-B" ] ; sld:type xsd:string , sld:null . cwl:outputSource ; sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . cwl:source . rdfs:comment "INT off-diagonal X-dropoff [100]" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-d" ] ; sld:type xsd:string , sld:null . cwl:outputBinding [ CommandOutputBinding:glob "$(inputs.input.basename.replace('bam', 'sorted.bam'))" ] ; cwl:outputBinding [ CommandOutputBinding:glob "$(inputs.input.basename.replace('bam', 'sorted.bam'))" ] ; cwl:outputBinding [ CommandOutputBinding:glob "$(inputs.input.basename.replace('bam', 'sorted.bam'))" ] ; cwl:outputBinding [ CommandOutputBinding:glob "$(inputs.input.basename.replace('bam', 'sorted.bam'))" ] ; sld:type cwl:File . rdfs:comment "Enable unsafe operations - nothing will be checked at runtime (ALLOW_N_CIGAR_READS| ALLOW_UNINDEXED_BAM| ALLOW_UNSET_BAM_SORT_ORDER| NO_READ_ORDER_VERIFICATION| ALLOW_SEQ_DICT_INCOMPATIBILITY| LENIENT_VCF_PROCESSING|ALL)" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--unsafe" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "Parameter to set a max coverage limit for Theoretical Sensitivity calculations. Default is 200. Default value - 200. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "COVERAGE_CAP=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "COVERAGE_CAP=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . sld:type xsd:string . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-a" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-a" ] ; sld:type xsd:boolean , sld:null . sld:type xsd:string . rdfs:comment "How strict should we be with validation (STRICT|LENIENT| SILENT)" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--validation_strictness" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:prefix "--markers" ] ; sld:type cwl:File , xsd:string . rdfs:comment "The output file to write marked records to Required." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "O=" ; CommandLineBinding:separate false ] ; sld:type xsd:string . rdfs:comment "The maximum offset between two duplicate clusters in order to consider them optical duplicates. The default is appropriate for unpatterned versions of the Illumina platform. For the patterned flowcell models, 2500 is moreappropriate. For other platforms and models, users should experiment to find what works best. Default value - 100. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "OPTICAL_DUPLICATE_PIXEL_DISTANCE=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:source . cwl:source . sld:type xsd:string . cwl:valueFrom "${ return [\"null\", \"SAMPLE\"];}" . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.S)\n return inputs.S;\n return null;\n}\n" ] ; sld:type cwl:File . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.H)\n return inputs.H;\n return null;\n}\n" ] ; sld:type cwl:File . cwl:source . rdfs:comment "Input bam file.\n" ; cwl:inputBinding [ CommandLineBinding:position 4 ] ; cwl:inputBinding [ CommandLineBinding:position 4 ] ; cwl:inputBinding [ CommandLineBinding:position 4 ] ; sld:type cwl:File . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MAX_RECORDS_IN_RAM=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "How should overlapping reads from the same" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--countType" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "Adapter sequence to be trimmed. If not specified explicitely, the first 13 bp of the Illumina adapter 'AGATCGGAAGAGC' will be used by default." ; cwl:inputBinding [ CommandLineBinding:prefix "--adapter" ] ; sld:type xsd:string , sld:null . cwl:source . rdfs:comment "This number is the maximum size of a set of duplicate reads for which we will attempt to determine which are optical duplicates. Please be aware that if you raise this value too high and do encounter a very large set of duplicate reads, it will severely affect the runtime of this tool. To completely disable this check, set the value to -1. Default value - 300000. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MAX_OPTICAL_DUPLICATE_SET_SIZE=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . rdfs:comment "Unit of time used by maxRuntime (NANOSECONDS|MICROSECONDS| MILLISECONDS|SECONDS|MINUTES| HOURS|DAYS)" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--maxRuntimeUnits" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . sld:type [ sld:items cwl:File ; sld:type sld:array ] . sld:type [ sld:items cwl:File ; sld:type sld:array ] . cwl:source . cwl:source . sld:type xsd:string . cwl:outputSource ; sld:type cwl:File . cwl:valueFrom "${ return \"all_reads_hsmerics_dump.txt\"; }" . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--MAX_OPTICAL_DUPLICATE_SET_SIZE" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--MAX_OPTICAL_DUPLICATE_SET_SIZE" ] ; sld:type xsd:float , sld:null . cwl:valueFrom "${ return inputs.I.basename.replace(\".bam\", \".ismetrics\")}" . rdfs:comment "filename2 to split" ; cwl:inputBinding [ CommandLineBinding:prefix "--fastq2" ] ; sld:type cwl:File . rdfs:comment "output in BAM format\n" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "-b" ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "-b" ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "-b" ] ; sld:type xsd:boolean . rdfs:comment "Run FastQC in the default mode on the FastQ file once trimming is complete.--fastqc_args \"\" Passes extra arguments to FastQC. If more than one argument is to be passed to FastQC they must be in the form \"arg1 arg2 etc.\". An example would be - --fastqc_args \"--nogroup --outdir /home/\". Passing extra arguments will automatically invoke FastQC, so --fastqc does not have to be specified separately." ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:prefix "--fastqc" ] ; sld:type xsd:boolean , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-H" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-H" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-H" ] ; sld:type xsd:boolean , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-W" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-W" ] ; sld:type xsd:int , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--input-bam" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--input-bam" ] ; sld:type cwl:File . sld:type xsd:string . rdfs:comment "If true (default), then the sort order in the header file will be ignored. Default value - true. This option can be set to 'null' to clear the default value. Possible values - {true, false}" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "ASSUME_SORTED=True" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "An interval list file that contains the locations of the targets. Default value - null. This option must be specified at least 1 times." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "TARGET_INTERVALS=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "TARGET_INTERVALS=" ; CommandLineBinding:separate false ] ; sld:type cwl:File . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-y" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-y" ] ; sld:type xsd:int , sld:null . sld:type [ sld:items xsd:string ; sld:type sld:array ] . a cwl:Workflow ; ns1:original_cwlVersion "v1.0" ; Workflow:steps , , , , ; cwl:cwlVersion ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:inputs , , , , , ; cwl:outputs , ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:SubworkflowFeatureRequirement ] ; cwl:requirements [ a cwl:ScatterFeatureRequirement ] ; cwl:requirements [ a cwl:MultipleInputFeatureRequirement ] ; cwl:requirements [ a cwl:StepInputExpressionRequirement ] . cwl:outputSource ; sld:type cwl:File . cwl:valueFrom "${ var data = []; data.push(inputs.r1); data.push(inputs.r2); return data; }" . rdfs:comment "Minimum mapping quality for a read to contribute coverage. Default value - 20. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MINIMUM_MAPPING_QUALITY=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MINIMUM_MAPPING_QUALITY=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:linkMerge "merge_flattened" ; cwl:source , . cwl:source . rdfs:comment "Fraction of reads to downsample to" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--downsample_to_fraction" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . sld:type [ sld:items xsd:string ; sld:type sld:array ] ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:in ; cwl:out , ; cwl:run . cwl:in , , , , , , , ; cwl:out , , , , , , , , , ; cwl:run . cwl:valueFrom "${ return inputs.I.basename.replace(\".bam\", \".gcbias.pdf\")}" . rdfs:comment "Assign a default base quality" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--defaultBaseQualities" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:source . a cwl:CommandLineTool ; ns1:original_cwlVersion "v1.2" ; cwl:arguments ( [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-R" ; cwl:valueFrom "@RG\\\\tID:$(inputs.lane_id)\\\\tSM:$(inputs.sample_id)\\\\tLB:$(inputs.sample_id)\\\\tPL:Illumina\\\\tPU:$(inputs.lane_id)" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-t" ; cwl:valueFrom "$(runtime.cores)" ] ) ; cwl:arguments ( [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-R" ; cwl:valueFrom "@RG\\\\tID:$(inputs.lane_id)\\\\tSM:$(inputs.sample_id)\\\\tLB:$(inputs.sample_id)\\\\tPL:Illumina\\\\tPU:$(inputs.lane_id)" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-t" ; cwl:valueFrom "$(runtime.cores)" ] ) ; cwl:baseCommand ( "bwa" "mem" ) ; cwl:baseCommand ( "bwa" "mem" ) ; cwl:cwlVersion ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:inputs , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , ; cwl:outputs ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/bwa_mem:0.7.12" ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 6 ; ResourceRequirement:ramMin 32000 ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/bwa_mem:0.7.12" ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 6 ; ResourceRequirement:ramMin 32000 ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:stdout "$(inputs.reads[0].basename.replace('fastq.gz', 'sam'))" . rdfs:comment "INT penalty for an unpaired read pair [17]" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-U" ] ; sld:type xsd:string , sld:null . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MAX_RECORDS_IN_RAM=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MAX_RECORDS_IN_RAM=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "INT band width for banded alignment [100]" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-w" ] ; sld:type xsd:string , sld:null . sld:type [ sld:fields , , , , , , , , , , , , , , ; sld:type sld:record ] . cwl:outputSource ; sld:type cwl:File . a cwl:CommandLineTool ; rdfs:comment "None\n" ; ns1:original_cwlVersion "v1.0" ; cwl:arguments ( [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-jar" ; CommandLineBinding:shellQuote false ; cwl:valueFrom "/usr/bin/picard-tools/picard.jar" ] [ CommandLineBinding:position 1 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "CollectGcBiasMetrics" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Xms$(Math.round(parseInt(runtime.ram)/1910))G" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Xmx$(Math.floor(parseInt(runtime.ram)/1048) - 1)G" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-XX:-UseGCOverheadLimit" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Djava.io.tmpdir=$(runtime.tmpdir)" ] [ CommandLineBinding:position 2 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "TMP_DIR=$(runtime.tmpdir)" ] ) ; cwl:baseCommand ( "java" ) ; cwl:cwlVersion ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:inputs , , , , , , , , , , , , , , , , , ; cwl:outputs , , ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 5 ; ResourceRequirement:ramMin 16000 ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-picard:2.9" ] . rdfs:comment "Just output sites without genotypes (i.e. only the first 8 columns of the VCF)" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--sites_only" ] ; sld:type xsd:boolean , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--PROGRAM_RECORD_ID" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--PROGRAM_RECORD_ID" ] ; sld:type xsd:string , sld:null . rdfs:comment "The program record ID for the @PG record(s) created by this program. Set to null to disable PG record creation. This string may have a suffix appended to avoid collision with other program record IDs. Default value - MarkDuplicates. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "PROGRAM_RECORD_ID=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "Read Group platform model Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "PM=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "Maximum number of file handles to keep open when spilling read ends to disk. Set this number a little lower than the per-process maximum number of file that may be open. This number can be found by executing the 'ulimit -n' command on a Unix system. Default value - 8000. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MAX_FILE_HANDLES_FOR_READ_ENDS_MAP=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "If true remove 'optical' duplicates and other duplicates that appear to have arisen from the sequencing process instead of the library preparation process, even if REMOVE_DUPLICATES is false. If REMOVE_DUPLICATES is true, all duplicates are removed and this option is ignored. Default value - false. This option can be set to 'null' to clear the default value. Possible values - {true, false}" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "REMOVE_SEQUENCING_DUPLICATES=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:outputBinding [ CommandOutputBinding:glob "*merged.bam" ] ; cwl:outputBinding [ CommandOutputBinding:glob "*merged.bam" ] ; sld:type cwl:File . rdfs:comment "If only one of the two paired-end reads became too short, the longer read will be written to either '.unpaired_1.fq' or '.unpaired_2.fq' output files. The length cutoff for unpaired single-end reads is governed by the parameters -r1/--length_1 and -r2/--length_2. Default - OFF." ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:prefix "--retain_unpaired" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "Regular expression that can be used to parse read names in the incoming SAM file. Read names are parsed to extract three variables - tile/region, x coordinate and y coordinate. These values are used to estimate the rate of optical duplication in order to give a more accurate estimated library size. Set this option to null to disable optical duplicate detection, e.g. for RNA-seq or other data where duplicate sets are extremely large and estimating library complexity is not an aim. Note that without optical duplicate counts, library size estimation will be inaccurate. The regular expression should contain three capture groups for the three variables, in order. It must match the entire read name. Note that if the default regex is specified, a regex match is not actually done, but instead the read name is split on colon character. For 5 element names, the 3rd, 4th and 5th elements are assumed to be tile, x and y values. For 7 element names (CASAVA 1.8), the 5th, 6th, and 7th elements are assumed to be tile, x and y values. Default value - . This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "READ_NAME_REGEX=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CREATE_INDEX=True" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "Stop after processing N reads, mainly for debugging. Default value - 0. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "STOP_AFTER=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:source . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--READ_TWO_BARCODE_TAG" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--READ_TWO_BARCODE_TAG" ] ; sld:type xsd:string , sld:null . rdfs:comment "skip pairing; mate rescue performed unless -S also in use" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-P" ] ; sld:type xsd:boolean , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-M" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-M" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "refactor cigar string with NDN elements to one element" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--refactor_NDN_cigar_string" ] ; sld:type xsd:boolean , sld:null . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . rdfs:comment "Output file (BAM or SAM). Required." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "O=" ; CommandLineBinding:separate false ] ; sld:type xsd:string . rdfs:comment "FLOAT look for internal seeds inside a seed longer than {-k} * FLOAT [1.5]" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-r" ] ; sld:type xsd:string , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--PROGRAM_GROUP_VERSION" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--PROGRAM_GROUP_VERSION" ] ; sld:type xsd:string , sld:null . cwl:source . sld:type xsd:string . sld:type cwl:File . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.O)\n return inputs.O;\n return null;\n}\n" ] ; sld:type cwl:File . a cwl:CommandLineTool ; ns1:original_cwlVersion "v1.2" ; dct:contributor [ ns2:mbox "mailto:bolipatc@mskcc.org" ; ns2:name "C. Allan Bolipata" ] ; dct:contributor [ ns2:mbox "mailto:bolipatc@mskcc.org" ; ns2:name "C. Allan Bolipata" ] ; dct:creator [ ns2:mbox "mailto:bolipatc@mskcc.org" ; ns2:name "C. Allan Bolipata" ] ; dct:creator [ ns2:mbox "mailto:bolipatc@mskcc.org" ; ns2:name "C. Allan Bolipata" ] ; cwl:arguments ( [ CommandLineBinding:position 0 ; cwl:valueFrom "$(inputs.input_bams[0].basename.replace('bam', 'merged.bam'))" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-test" ] ) ; cwl:arguments ( [ CommandLineBinding:position 0 ; cwl:valueFrom "$(inputs.input_bams[0].basename.replace('bam', 'merged.bam'))" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-test" ] ) ; cwl:baseCommand ( "samtools" "merge" ) ; cwl:baseCommand ( "samtools" "merge" ) ; cwl:cwlVersion ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:inputs ; cwl:outputs ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mjblow/samtools-1.9:latest" ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mjblow/samtools-1.9:latest" ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 6 ; ResourceRequirement:ramMin 32000 ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 6 ; ResourceRequirement:ramMin 32000 ] . rdfs:comment "Value of CL tag of PG record to be created. If not supplied the command line will be detected automatically. Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "PROGRAM_GROUP_COMMAND_LINE=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "Do not calculate per-sample per-depth counts of loci" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--omitLocusTable" ] ; sld:type xsd:boolean , sld:null . cwl:inputBinding [ CommandLineBinding:position 2 ] ; sld:type cwl:File . cwl:in , , , , , , ; cwl:out ; cwl:run . cwl:source . a cwl:ExpressionTool ; ns1:original_cwlVersion "v1.0" ; ExpressionTool:expression "${\n var r1_files = [];\n var r2_files = [];\n\n for (var i = 0; i < inputs.reads_dir.listing.length; i++) {\n var current_file_obj = inputs.reads_dir.listing[i];\n if (current_file_obj.class == \"Directory\"){\n for (var j = 0; j < current_file_obj.listing.length; j++) {\n var current_fastq = current_file_obj.listing[j];\n if ( current_fastq.basename.includes(\"_R1_\")){\n r1_files.push(current_fastq);\n }\n else if ( current_fastq.basename.includes(\"_R2_\")){\n r2_files.push(current_fastq);\n }\n }\n }\n }\n\n return {\n 'r1': r1_files,\n 'r2': r2_files\n };\n}\n" ; cwl:cwlVersion ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:inputs ; cwl:outputs , ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] . cwl:in , , , ; cwl:out ; cwl:outputSource ; cwl:run ; sld:type cwl:File . a cwl:Workflow ; ns1:original_cwlVersion "v1.0" ; Workflow:steps , , , , , , , , ; cwl:cwlVersion ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:inputs , , , , , , , , , ; cwl:outputs , , , , , , , , , , , , , , ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:ScatterFeatureRequirement ] ; cwl:requirements [ a cwl:MultipleInputFeatureRequirement ] ; cwl:requirements [ a cwl:SubworkflowFeatureRequirement ] ; cwl:requirements [ a cwl:StepInputExpressionRequirement ] . rdfs:comment "RG/PU ID" ; cwl:inputBinding [ CommandLineBinding:prefix "--platform-unit" ] ; sld:type xsd:string , sld:null . rdfs:comment "The output file to write the metrics to. Required." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "O=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "O=" ; CommandLineBinding:separate false ] ; sld:type xsd:string . cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; sld:type cwl:File . cwl:in ; cwl:out ; cwl:run . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-U" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-U" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-U" ] ; sld:type cwl:File , sld:null . rdfs:comment "Trim low-quality ends from reads in addition to adapter removal. For RRBS samples, quality trimming will be performed first, and adapter trimming is carried in a second round. Other files are quality and adapter trimmed in a single pass. The algorithm is the same as the one used by BWA (Subtract INT from all qualities; compute partial sums from all indices to the end of the sequence; cut sequence at the index at which the sum is minimal). Default Phred score - 20." ; cwl:default "1" ; cwl:inputBinding [ CommandLineBinding:prefix "--quality" ] ; sld:type xsd:string , sld:null . cwl:valueFrom "${ return true; }" . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-H" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-H" ] ; sld:type cwl:File , xsd:string , sld:null . cwl:source . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-j" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-j" ] ; sld:type cwl:File , sld:null . sld:type xsd:string . cwl:source . rdfs:comment "Remove program records from the SAM header" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--remove_program_records" ] ; sld:type xsd:boolean , sld:null . cwl:source . cwl:outputSource ; sld:type cwl:File . cwl:outputSource ; sld:type cwl:File . rdfs:comment "GATK key file required to run with -et NO_ET" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--gatk_key" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--PROGRAM_GROUP_NAME" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--PROGRAM_GROUP_NAME" ] ; sld:type xsd:string , sld:null . rdfs:comment "The maximum distance between a read and the nearest probe/bait/amplicon for the read to be considered 'near probe' and included in percent selected. Default value - 250. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "NEAR_DISTANCE=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "NEAR_DISTANCE=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . sld:type xsd:string , sld:null . cwl:source . cwl:source . cwl:default true ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CREATE_INDEX=True" ] ; sld:type xsd:boolean , sld:null . a cwl:Workflow ; Workflow:steps , , , ; cwl:inputs , , , , , , , , , , , , ; cwl:outputs , , . rdfs:comment "Number of reads per SAM file to buffer in memory" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--read_buffer_size" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "VERBOSITY=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-C" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-C" ] ; sld:type xsd:boolean , sld:null . sld:type xsd:string . cwl:source . cwl:valueFrom "${ return true; }" . cwl:source . rdfs:comment "Specifies that the input file was an MspI digested RRBS sample (recognition site - CCGG). Sequences which were adapter-trimmed will have a further 2 bp removed from their 3' end. This is to avoid that the filled-in C close to the second MspI site in a sequence is used for methylation calls. Sequences which were merely trimmed because of poor quality will not be shortened further." ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:prefix "--rrbs" ] ; sld:type xsd:boolean , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--PROGRAM_GROUP_COMMAND_LINE" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--PROGRAM_GROUP_COMMAND_LINE" ] ; sld:type xsd:string , sld:null . cwl:outputSource ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-e" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-e" ] ; sld:type xsd:boolean , sld:null . a cwl:ExpressionTool ; ns1:original_cwlVersion "v1.0" ; ExpressionTool:expression "${ var fastq1 = []; var fastq2 =[]; var add_rg_ID = []; var add_rg_PU = []; for (var i = 0; i < inputs.fastq1.length; i++) { for (var j =0; j < inputs.fastq1[i].length; j++) { fastq1.push(inputs.fastq1[i][j]); fastq2.push(inputs.fastq2[i][j]); } } fastq1 = fastq1.sort(function(a,b) { if (a['basename']< b['basename']) { return -1; } else if(a['basename'] > b['basename']) { return 1; } else { return 0; } }); fastq2 = fastq2.sort(function(a,b) { if (a['basename']< b['basename']) { return -1; } else if(a['basename'] > b['basename']) { return 1; } else { return 0; }}); for (var i =0; i < fastq1.length; i++) { for(var j=0; j < inputs.add_rg_PU.length; j++) { if (fastq1[i].basename.includes(inputs.add_rg_PU[j])) { add_rg_ID.push(inputs.add_rg_ID[j]); add_rg_PU.push(inputs.add_rg_PU[j]); } } } var returnobj = {}; returnobj['chunks1'] = fastq1; returnobj['chunks2'] = fastq2; returnobj['rg_ID']= add_rg_ID; returnobj['rg_PU']= add_rg_PU; return returnobj; }" ; cwl:cwlVersion ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:inputs , , , ; cwl:outputs , , , ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] . cwl:inputBinding [ CommandLineBinding:position 2 ] ; sld:type cwl:File . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--SORTING_COLLECTION_SIZE_RATIO" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--SORTING_COLLECTION_SIZE_RATIO" ] ; sld:type xsd:float , sld:null . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "COMPRESSION_LEVEL=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "The scoring strategy for choosing the non-duplicate among candidates. Default value - SUM_OF_BASE_QUALITIES. This option can be set to 'null' to clear the default value. Possible values - {SUM_OF_BASE_QUALITIES, TOTAL_MAPPED_REFERENCE_LENGTH, RANDOM}" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "DUPLICATE_SCORING_STRATEGY=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "The size of the scanning windows on the reference genome that are used to bin reads. Default value - 100. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "SCAN_WINDOW_SIZE=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:inputBinding [ CommandLineBinding:position 1 ] ; sld:type cwl:File . rdfs:comment "BAQ gap open penalty" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--baqGapOpenPenalty" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:source . cwl:valueFrom "${ return inputs.basebamname.replace(\".bam\", \".\" + inputs.fastq1.basename.match(/chunk\\d\\d\\d/)[0] + \".sam\");}" . sld:type xsd:string . rdfs:comment "filter out reads with CIGAR containing the N operator, instead of stop processing and report an error." ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--filter_reads_with_N_cigar" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "Do not calculate per-interval statistics" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--omitIntervalStatistics" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "INT score for a sequence match [1]" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-A" ] ; sld:type xsd:string , sld:null . cwl:outputSource ; sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . rdfs:comment "INT skip seeds with more than INT occurrences [10000]" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-c" ] ; sld:type xsd:string , sld:null . cwl:source . sld:type [ sld:items xsd:string ; sld:type sld:array ] ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . sld:type xsd:string . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--READ_NAME_REGEX" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--READ_NAME_REGEX" ] ; sld:type xsd:string , sld:null . rdfs:comment "temporary directory to set -Djava.io.tmpdir" ; cwl:inputBinding [ CommandLineBinding:prefix "--temp_dir_java" ] ; sld:type xsd:string , sld:null . rdfs:label "bwa_sort" ; cwl:in , , , , , ; cwl:out , , ; cwl:run ; cwl:scatter ( ) ; cwl:scatter ( ) ; cwl:scatterMethod ScatterMethod:dotproduct . cwl:source . cwl:source . rdfs:comment "Read Group run date Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "DT=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . a cwl:CommandLineTool ; rdfs:comment "None\n" ; ns1:original_cwlVersion "v1.0" ; cwl:arguments ( [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-jar" ; CommandLineBinding:shellQuote false ; cwl:valueFrom "/usr/bin/picard-tools/picard.jar" ] [ CommandLineBinding:position 1 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "AddOrReplaceReadGroups" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Xms$(Math.round(parseInt(runtime.ram)/1910))G" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Xmx$(Math.floor(parseInt(runtime.ram)/1048) - 1)G" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-XX:-UseGCOverheadLimit" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Djava.io.tmpdir=$(runtime.tmpdir)" ] [ CommandLineBinding:position 2 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "TMP_DIR=$(runtime.tmpdir)" ] ) ; cwl:baseCommand ( "java" ) ; cwl:cwlVersion ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:inputs , , , , , , , , , , , , , , , , , , , , , , ; cwl:outputs , ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 5 ; ResourceRequirement:ramMin 25000 ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-picard:2.9" ] . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--CLEAR_DT" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--CLEAR_DT" ] ; sld:type xsd:boolean , sld:null . cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CREATE_MD5_FILE=True" ] ; sld:type xsd:boolean , sld:null . cwl:outputBinding [ CommandOutputBinding:glob "${\n var pattern = inputs.platform_unit + \"-\" + inputs.fastq2.basename.split(\".\",1)[0].split('_').slice(1).join(\"-\") + \".chunk*\";\n return pattern\n}\n" ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . cwl:outputBinding [ CommandOutputBinding:glob "${\n return inputs.output_dir;\n }\n" ] ; cwl:outputBinding [ CommandOutputBinding:glob "${\n return inputs.output_dir;\n }\n" ] ; sld:type cwl:Directory . rdfs:comment "to get additional results without duplicates. This option allows to gain two plots per level at the same time - one is the usual one and the other excludes duplicates. Default value - false. This option can be set to 'null' to clear the default value. Possible values - {true, false}" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "ALSO_IGNORE_DUPLICATES=True" ] ; sld:type xsd:boolean , sld:null . cwl:valueFrom "${ return true; }" . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--DUPLICATE_SCORING_STRATEGY" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--DUPLICATE_SCORING_STRATEGY" ] ; sld:type xsd:string , sld:null . cwl:source . cwl:source . sld:type xsd:string . sld:type cwl:File . rdfs:comment "Tag to identify this GATK run as part of a group of runs" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--tag" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:position 1 ] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; sld:type cwl:File . a cwl:CommandLineTool ; rdfs:comment "None\n" ; ns1:original_cwlVersion "v1.0" ; cwl:arguments ( [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-jar" ; CommandLineBinding:shellQuote false ; cwl:valueFrom "/usr/bin/picard-tools/picard.jar" ] [ CommandLineBinding:position 1 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "CollectHsMetrics" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Xms$(Math.round(parseInt(runtime.ram)/1910))G" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Xmx$(Math.floor(parseInt(runtime.ram)/1048) - 1)G" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-XX:-UseGCOverheadLimit" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Djava.io.tmpdir=$(runtime.tmpdir)" ] [ CommandLineBinding:position 2 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "TMP_DIR=$(runtime.tmpdir)" ] ) ; cwl:arguments ( [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-jar" ; CommandLineBinding:shellQuote false ; cwl:valueFrom "/usr/bin/picard-tools/picard.jar" ] [ CommandLineBinding:position 1 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "CollectHsMetrics" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Xms$(Math.round(parseInt(runtime.ram)/1910))G" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Xmx$(Math.floor(parseInt(runtime.ram)/1048) - 1)G" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-XX:-UseGCOverheadLimit" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Djava.io.tmpdir=$(runtime.tmpdir)" ] [ CommandLineBinding:position 2 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "TMP_DIR=$(runtime.tmpdir)" ] ) ; cwl:baseCommand ( "java" ) ; cwl:baseCommand ( "java" ) ; cwl:cwlVersion ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:inputs , , , , , , , , , , , , , , , , , , , , , ; cwl:outputs , ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 5 ; ResourceRequirement:ramMin 16000 ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 5 ; ResourceRequirement:ramMin 16000 ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-picard:2.9" ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-picard:2.9" ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--arguments_file" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--arguments_file" ] ; sld:type cwl:File , sld:null . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.O)\n return inputs.O;\n return null;\n}\n" ] ; cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.O)\n return inputs.O;\n return null;\n}\n" ] ; sld:type cwl:File . rdfs:comment "Barcode SAM tag (ex. BC for 10X Genomics) Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "BARCODE_TAG=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . a cwl:Workflow ; rdfs:label "bwa_sort" ; ns1:original_cwlVersion "v1.0" ; Workflow:steps , , ; cwl:cwlVersion ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:inputs , , , ; cwl:outputs , , . sld:type [ sld:items cwl:Directory ; sld:type sld:array ] ; sld:type [ sld:items cwl:Directory ; sld:type sld:array ] . cwl:source . cwl:in , , , ; cwl:out , , , ; cwl:run . sld:type [ sld:items cwl:File ; sld:type sld:array ] . cwl:outputSource ; sld:type cwl:File . sld:type [ sld:items cwl:File ; sld:type sld:array ] . rdfs:comment "Enable threading efficiency monitoring" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--monitorThreadEfficiency" ] ; sld:type xsd:boolean , sld:null . cwl:inputBinding [ CommandLineBinding:position 2 ] ; sld:type [ cwl:inputBinding [ CommandLineBinding:prefix "I=" ; CommandLineBinding:separate false ] ; sld:items cwl:File ; sld:type sld:array ] . cwl:outputSource ; sld:type cwl:File . rdfs:comment "If provided, output BAM files will be simplified to include just key reads for downstream variation discovery analyses (removing duplicates, PF-, non-primary reads), as well stripping all extended tags from the kept reads except the read group identifier" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--simplifyBAM" ] ; sld:type xsd:boolean , sld:null . cwl:source . cwl:outputSource ; sld:type cwl:File . rdfs:comment "Do not output depth of coverage at each base" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--omitDepthOutputAtEachBase" ] ; sld:type xsd:boolean , sld:null . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.PER_TARGET_COVERAGE)\n return inputs.PER_TARGET_COVERAGE;\n return null;\n}\n" ] ; cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.PER_TARGET_COVERAGE)\n return inputs.PER_TARGET_COVERAGE;\n return null;\n}\n" ] ; sld:type cwl:File , sld:null . cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CREATE_MD5_FILE=True" ] ; sld:type xsd:boolean , sld:null . cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "QUIET=True" ] ; sld:type xsd:boolean , sld:null . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--READ_ONE_BARCODE_TAG" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--READ_ONE_BARCODE_TAG" ] ; sld:type xsd:string , sld:null . cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CREATE_MD5_FILE=True" ] ; sld:type xsd:boolean , sld:null . cwl:outputSource ; sld:type cwl:File . rdfs:comment "File to write the output to. Required." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "O=" ; CommandLineBinding:separate false ] ; sld:type xsd:string . rdfs:comment "For summary metrics, exclude GC windows that include less than this fraction of the genome. Default value - 1.0E-5. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MINIMUM_GENOME_FRACTION=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "List of adapter sequences to use when processing the alignment metrics. Default value - [AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG]. This option can be set to 'null' to clear the default value. This option may be specified 0 or more times. This option can be set to 'null' to clear the default list." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "ADAPTER_SEQUENCE=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:source . rdfs:comment "integer part sets seed of random number generator [0];\nrest sets fraction of templates to subsample [no subsampling]\n" ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-s" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-s" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-s" ] ; sld:type xsd:float , sld:null . cwl:valueFrom "${ return inputs.I.basename.replace(\".bam\", \".hsmetrics\")}" . rdfs:comment "filename to split" ; cwl:inputBinding [ CommandLineBinding:prefix "--fastq1" ] ; sld:type cwl:File . cwl:source . cwl:outputSource ; sld:type cwl:File . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "REFERENCE_SEQUENCE=" ; CommandLineBinding:separate false ] ; sld:type cwl:File . cwl:source . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-V" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-V" ] ; sld:type xsd:boolean , sld:null . cwl:source . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-x" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-x" ] ; sld:type xsd:string , sld:null . cwl:default "bwa" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--aligner" ] ; sld:type xsd:string , sld:null . cwl:source . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--no-sort" ] ; sld:type xsd:string , sld:null . cwl:in , , , , ; cwl:out , , ; cwl:run . sld:type xsd:string . cwl:linkMerge "merge_flattened" ; cwl:source , . sld:type xsd:string . cwl:default true ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CREATE_INDEX=True" ] ; sld:type xsd:boolean , sld:null . cwl:source . rdfs:comment "Paired-end reads above this insert size will be considered chimeric along with inter-chromosomal pairs. Default value - 100000. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MAX_INSERT_SIZE=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "Write GATK runtime performance log to this file" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--performanceLog" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:source . cwl:source . cwl:outputBinding [ CommandOutputBinding:glob "${\n return inputs.output_dir.concat('/*.disambiguatedSpeciesB.bam');\n}\n" ] ; sld:type cwl:File . cwl:in , , , , ; cwl:out , , ; cwl:outputSource ; cwl:run ; sld:type cwl:File . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . cwl:outputSource ; sld:type cwl:File . sld:type cwl:File . cwl:valueFrom "${ return true; }" . cwl:source . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MAX_RECORDS_IN_RAM=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.O)\n return inputs.O;\n return null;\n}\n" ] ; sld:type cwl:File . cwl:source . cwl:source . rdfs:comment "Input bam file." ; cwl:inputBinding [ CommandLineBinding:position 1 ] ; cwl:inputBinding [ CommandLineBinding:position 1 ] ; cwl:inputBinding [ CommandLineBinding:position 1 ] ; cwl:inputBinding [ CommandLineBinding:position 1 ] ; sld:type cwl:File . rdfs:comment "INT minimum score to output [30]" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-T" ] ; sld:type xsd:string , sld:null . cwl:outputSource ; sld:type xsd:string . a cwl:CommandLineTool ; rdfs:comment "None\n" ; ns1:original_cwlVersion "v1.0" ; cwl:arguments ( [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-jar" ; CommandLineBinding:shellQuote false ; cwl:valueFrom "/usr/bin/picard-tools/picard.jar" ] [ CommandLineBinding:position 1 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "MarkDuplicates" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Xms$(Math.round(parseInt(runtime.ram)/1910))G" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Xmx$(Math.floor(parseInt(runtime.ram)/1048) - 1)G" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-XX:-UseGCOverheadLimit" ] [ CommandLineBinding:position 0 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "-Djava.io.tmpdir=$(runtime.tmpdir)" ] [ CommandLineBinding:position 2 ; CommandLineBinding:shellQuote false ; cwl:valueFrom "TMP_DIR=$(runtime.tmpdir)" ] ) ; cwl:baseCommand ( "java" ) ; cwl:cwlVersion ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:inputs , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , ; cwl:outputs , , ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-picard:2.9" ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 5 ; ResourceRequirement:ramMin 42000 ] . rdfs:comment "INT verbose level - 1=error, 2=warning, 3=message, 4+=debugging [3]" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-v" ] ; sld:type xsd:string , sld:null . rdfs:comment "An optional file to output per target coverage information to. Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "PER_TARGET_COVERAGE=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "PER_TARGET_COVERAGE=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:valueFrom "${ return \"bwa\"; }" . cwl:source . cwl:source . cwl:source . rdfs:comment "Read Group platform (e.g. illumina, solid) Required." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "PL=" ; CommandLineBinding:separate false ] ; sld:type xsd:string . cwl:valueFrom "${ return true; }" . cwl:valueFrom "${ return inputs.I.basename.replace(\".bam\", \".asmetrics\")}" . a cwl:CommandLineTool ; ns1:original_cwlVersion "v1.0" ; cwl:arguments ( [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--tmp-dir" ; CommandLineBinding:shellQuote false ; cwl:valueFrom "$(runtime.tmpdir)" ] ) ; cwl:arguments ( [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--tmp-dir" ; CommandLineBinding:shellQuote false ; cwl:valueFrom "$(runtime.tmpdir)" ] ) ; cwl:baseCommand ( "perl" "/opt/unpack_bam.pl" ) ; cwl:baseCommand ( "perl" "/opt/unpack_bam.pl" ) ; cwl:cwlVersion ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:inputs , , , ; cwl:outputs ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 4 ; ResourceRequirement:ramMin 16000 ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 4 ; ResourceRequirement:ramMin 16000 ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/unpack_bam:0.1.0" ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/unpack_bam:0.1.0" ] . cwl:source . cwl:source . cwl:source . rdfs:comment "only include reads overlapping this BED FILE [null]\n" ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-L" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-L" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-L" ] ; sld:type cwl:File , sld:null . a cwl:Workflow ; ns1:original_cwlVersion "v1.0" ; Workflow:steps , , ; cwl:cwlVersion ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:inputs , ; cwl:outputs , ; cwl:requirements [ a cwl:ScatterFeatureRequirement ] ; cwl:requirements [ a cwl:StepInputExpressionRequirement ] ; cwl:requirements [ a cwl:StepInputExpressionRequirement ] ; cwl:requirements [ a cwl:MultipleInputFeatureRequirement ] ; cwl:requirements [ a cwl:MultipleInputFeatureRequirement ] ; cwl:requirements [ a cwl:SubworkflowFeatureRequirement ] ; cwl:requirements [ a cwl:SubworkflowFeatureRequirement ] ; cwl:requirements [ a cwl:ScatterFeatureRequirement ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] . cwl:source . rdfs:comment "If true, also include reads marked as duplicates in the insert size histogram. Default value - false. This option can be set to 'null' to clear the default value. Possible values - {true, false}" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "INCLUDE_DUPLICATES=True" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "If true (default), then the sort order in the header file will be ignored. Default value - true. This option can be set to 'null' to clear the default value. Possible values - {true, false}" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "ASSUME_SORTED=True" ; CommandLineBinding:separate false ] ; sld:type xsd:boolean , sld:null . rdfs:comment "INT gap open penalty [6]" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-O" ] ; sld:type xsd:string , sld:null . sld:type cwl:Directory . cwl:inputBinding [ CommandLineBinding:itemSeparator "," ; CommandLineBinding:position 0 ; CommandLineBinding:prefix "-L" ] ; cwl:inputBinding [ CommandLineBinding:itemSeparator "," ; CommandLineBinding:position 0 ; CommandLineBinding:prefix "-L" ] ; sld:type sld:null ; sld:type [ sld:items xsd:int ; sld:type sld:array ] ; sld:type [ sld:items xsd:int ; sld:type sld:array ] . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . sld:type [ sld:items xsd:string ; sld:type sld:array ] ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "Starting (left endpoint) for granular binning" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--start" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . sld:type xsd:string . cwl:source . rdfs:comment "If true (default), then the sort order in the header file will be ignored. Default value - true. This option can be set to 'null' to clear the default value. Possible values - {true, false}" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "ASSUME_SORTED=True" ; CommandLineBinding:separate false ] ; sld:type xsd:boolean , sld:null . rdfs:comment "only include reads in read group STR [null]\n" ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-r" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-r" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-r" ] ; sld:type xsd:string , sld:null . rdfs:comment "Read Group program group Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "PG=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . sld:type xsd:string . cwl:inputBinding [ CommandLineBinding:position 1 ] ; sld:type cwl:File . cwl:inputBinding [ CommandLineBinding:position 2 ] ; cwl:inputBinding [ CommandLineBinding:position 2 ] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; sld:type cwl:File . rdfs:comment "Calculate coverage statistics over this list of genes" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--calculateCoverageOverGenes" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "Stop after processing N reads, mainly for debugging. Default value - 0. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "STOP_AFTER=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:in , ; cwl:out ; cwl:run ; cwl:scatter ( ) ; cwl:scatter ( ) ; cwl:scatterMethod ScatterMethod:dotproduct . rdfs:comment "If true do not write duplicates to the output file instead of writing them with appropriate flags set. Default value - false. This option can be set to 'null' to clear the default value. Possible values - {true, false}" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "REMOVE_DUPLICATES=True" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "Bait set name. If not provided it is inferred from the filename of the bait intervals. Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "BAIT_SET_NAME=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "BAIT_SET_NAME=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . sld:type xsd:string . sld:type [ sld:items cwl:File ; sld:type sld:array ] . rdfs:comment "only include reads with all bits set in INT set in FLAG [0]\n" ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-f" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-f" ] ; cwl:inputBinding [ CommandLineBinding:position 1 ; CommandLineBinding:prefix "-f" ] ; sld:type xsd:int , sld:null . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "I=" ; CommandLineBinding:separate false ] ; sld:type cwl:File . a cwl:CommandLineTool ; rdfs:comment "Sort alignments by leftmost coordinates, or by read name when -n is used. An appropriate @HD-SO sort order header tag will be added or an existing one updated if necessary.\n\nUsage: samtools sort [-l level] [-m maxMem] [-o out.bam] [-O format] [-n] -T out.prefix [-@ threads] [in.bam]\n\nOptions:\n-l INT\nSet the desired compression level for the final output file, ranging from 0 (uncompressed) or 1 (fastest but minimal compression) to 9 (best compression but slowest to write), similarly to gzip(1)'s compression level setting.\n\nIf -l is not used, the default compression level will apply.\n\n-m INT\nApproximately the maximum required memory per thread, specified either in bytes or with a K, M, or G suffix. [768 MiB]\n\n-n\nSort by read names (i.e., the QNAME field) rather than by chromosomal coordinates.\n\n-o FILE\nWrite the final sorted output to FILE, rather than to standard output.\n\n-O FORMAT\nWrite the final output as sam, bam, or cram.\n\nBy default, samtools tries to select a format based on the -o filename extension; if output is to standard output or no format can be deduced, -O must be used.\n\n-T PREFIX\nWrite temporary files to PREFIX.nnnn.bam. This option is required.\n\n-@ INT\nSet number of sorting and compression threads. By default, operation is single-threaded\n" ; ns1:original_cwlVersion "v1.0" ; cwl:arguments ( [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-o" ; cwl:valueFrom "$(inputs.input.basename.replace('bam', 'sorted.bam'))" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-@" ; cwl:valueFrom "$(runtime.cores)" ] ) ; cwl:arguments ( [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-o" ; cwl:valueFrom "$(inputs.input.basename.replace('bam', 'sorted.bam'))" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-@" ; cwl:valueFrom "$(runtime.cores)" ] ) ; cwl:arguments ( [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-o" ; cwl:valueFrom "$(inputs.input.basename.replace('bam', 'sorted.bam'))" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-@" ; cwl:valueFrom "$(runtime.cores)" ] ) ; cwl:arguments ( [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-o" ; cwl:valueFrom "$(inputs.input.basename.replace('bam', 'sorted.bam'))" ] [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-@" ; cwl:valueFrom "$(runtime.cores)" ] ) ; cwl:baseCommand ( "/usr/bin/samtools" "sort" ) ; cwl:baseCommand ( "/usr/bin/samtools" "sort" ) ; cwl:baseCommand ( "/usr/bin/samtools" "sort" ) ; cwl:baseCommand ( "/usr/bin/samtools" "sort" ) ; cwl:cwlVersion ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:inputs , , , , , ; cwl:outputs ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-samtools:1.3.1" ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-samtools:1.3.1" ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-samtools:1.3.1" ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 6 ; ResourceRequirement:ramMin 32000 ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 6 ; ResourceRequirement:ramMin 32000 ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 6 ; ResourceRequirement:ramMin 32000 ] ; cwl:requirements [ a cwl:DockerRequirement ; DockerRequirement:dockerPull "mskcc/roslin-variant-samtools:1.3.1" ] ; cwl:requirements [ a cwl:ResourceRequirement ; ResourceRequirement:coresMin 6 ; ResourceRequirement:ramMin 32000 ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] . cwl:valueFrom "${ return [\"ALL_READS\"];}" . sld:type xsd:string . rdfs:comment "Keep the quality trimmed intermediate file. Default - off, which means the temporary file is being deleted after adapter trimming. Only has an effect for RRBS samples since other FastQ files are not trimmed for poor qualities separately.Note for RRBS using MseI -If your DNA material was digested with MseI (recognition motif - TTAA) instead of MspI it is NOT necessaryto specify --rrbs or --non_directional since virtually all reads should start with the sequence'TAA', and this holds true for both directional and non-directional libraries. As the end-repair of 'TAA'restricted sites does not involve any cytosines it does not need to be treated especially. Instead, simplyrun Trim Galore! in the standard (i.e. non-RRBS) mode.Paired-end specific options -" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:prefix "--keep" ] ; sld:type xsd:boolean , sld:null . sld:type xsd:string . cwl:source . cwl:source . cwl:in , , , ; cwl:out ; cwl:run . rdfs:comment "Emit the OQ tag with the original base qualities (with -BQSR)" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--emit_original_quals" ] ; sld:type xsd:boolean , sld:null . cwl:source . cwl:source . cwl:in ; cwl:out ; cwl:run . sld:type [ sld:items cwl:File ; sld:type sld:array ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.O)\n return inputs.O.replace(/^.*[\\\\\\/]/, '').replace(/\\.[^/.]+$/, '').replace(/\\.bam/,'') + \".bai\";\n return null;\n}" ] ; sld:type cwl:File , sld:null . rdfs:comment "Number of bins to use for granular binning" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--nBins" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:in , , , , , ; cwl:out ; cwl:run . cwl:in , , , ; cwl:out , ; cwl:outputSource ; cwl:run ; sld:type cwl:File . cwl:valueFrom "${ return inputs.I[0].basename.replace(/\\.chunk\\d\\d\\d\\.rg\\.bam/, \".rg.md.bam\") }" . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "COMPRESSION_LEVEL=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "COMPRESSION_LEVEL=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:in , , , , , ; cwl:out , ; cwl:outputSource ; cwl:run ; sld:type cwl:File . sld:type [ sld:items [ sld:items xsd:string ; sld:type sld:array ] ; sld:type sld:array ] ; sld:type [ sld:items [ sld:items xsd:string ; sld:type sld:array ] ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "I=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "I=" ; CommandLineBinding:separate false ] ; sld:type cwl:File . rdfs:comment "INT gap extension penalty; a gap of size k cost {-O} + {-E}*k [1]" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-E" ] ; sld:type xsd:string , sld:null . cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; sld:type cwl:File . a cwl:Workflow ; rdfs:label "align_sample" ; ns1:original_cwlVersion "v1.0" ; Workflow:steps , , ; cwl:cwlVersion ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:hints [ a ; NetworkAccess:networkAccess true ] ; cwl:hints [ a ; LoadListingRequirement:loadListing "deep_listing" ] ; cwl:inputs , , , , ; cwl:outputs , , , ; cwl:requirements [ a cwl:StepInputExpressionRequirement ] ; cwl:requirements [ a cwl:ScatterFeatureRequirement ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:ScatterFeatureRequirement ] ; cwl:requirements [ a cwl:InlineJavascriptRequirement ] ; cwl:requirements [ a cwl:SubworkflowFeatureRequirement ] ; cwl:requirements [ a cwl:StepInputExpressionRequirement ] ; cwl:requirements [ a cwl:SubworkflowFeatureRequirement ] . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-B" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-B" ] ; sld:type xsd:int , sld:null . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "COMPRESSION_LEVEL=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:outputSource ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-d" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-d" ] ; sld:type xsd:int , sld:null . rdfs:comment "Comment(s) to include in the output file's header. Default value - null. This option may be specified 0 or more times." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "COMMENT=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "Read one barcode SAM tag (ex. BX for 10X Genomics) Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "READ_ONE_BARCODE_TAG=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:default "SILENT" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "VALIDATION_STRINGENCY=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:outputSource ; sld:type cwl:File . sld:type xsd:string . cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; sld:type cwl:File . cwl:outputSource ; sld:type cwl:File . rdfs:comment "read tag to strip (repeatable) [null]\n" ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-x" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-x" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-x" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] ; sld:type [ sld:items xsd:string ; sld:type sld:array ] ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . cwl:source . cwl:valueFrom "${ return true; }" . cwl:outputSource ; sld:type cwl:File . rdfs:comment "Type of read downsampling to employ at a given locus (NONE| ALL_READS|BY_SAMPLE)" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--downsampling_type" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . sld:type xsd:string . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-x" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-x" ] ; cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "-x" ] ; sld:type cwl:File , sld:null . rdfs:comment "Ending (right endpoint) for granular binning" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--stop" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . sld:type cwl:File . cwl:source . rdfs:comment "Use a non-deterministic random seed" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--nonDeterministicRandomSeed" ] ; sld:type xsd:boolean , sld:null . rdfs:comment "Enable on-the-fly creation of" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--generate_md5" ] ; sld:type xsd:boolean , sld:null . cwl:default "SILENT" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "VALIDATION_STRINGENCY=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; sld:type cwl:File . cwl:source . rdfs:comment "File to write duplication metrics to Required." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "METRICS_FILE=" ; CommandLineBinding:separate false ] ; sld:type xsd:string . cwl:in , , , , , , , , ; cwl:out , ; cwl:run . rdfs:comment "Read Group description Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "DS=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:outputBinding [ CommandOutputBinding:glob "${\n var pattern = inputs.platform_unit + \"-\" + inputs.fastq1.basename.split(\".\",1)[0].split('_').slice(1).join(\"-\") + \".chunk*\";\n return pattern\n}\n" ] ; sld:type [ sld:items cwl:File ; sld:type sld:array ] . rdfs:comment "Turn off on-the-fly creation of" ; cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--disable_bam_indexing" ] ; sld:type xsd:boolean , sld:null . cwl:in , ; cwl:out , ; cwl:run . rdfs:comment "An optional file to output per base coverage information to. The per-base file contains one line per target base and can grow very large. It is not recommended for use with large target sets. Default value - null." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "PER_BASE_COVERAGE=" ; CommandLineBinding:separate false ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "PER_BASE_COVERAGE=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CREATE_MD5_FILE=True" ] ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CREATE_MD5_FILE=True" ] ; sld:type xsd:boolean , sld:null . cwl:source . rdfs:comment "Exclude read groups based on tags" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--read_group_black_list" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . sld:type xsd:string . cwl:source . cwl:source . cwl:outputBinding [ CommandOutputBinding:glob "${\n if (inputs.outfile)\n return inputs.outfile;\n return null;\n}\n" ] ; sld:type cwl:File . cwl:inputBinding [ CommandLineBinding:position 0 ; CommandLineBinding:prefix "--prefix" ] ; sld:type xsd:string . sld:type xsd:string . sld:type xsd:string . rdfs:comment "This option is obsolete. ReadEnds will always be spilled to disk. Default value - 50000. This option can be set to 'null' to clear the default value." ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . cwl:default false ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "CREATE_INDEX=True" ] ; sld:type xsd:boolean , sld:null . sld:type cwl:File . cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; cwl:secondaryFiles [] ; sld:type cwl:File . cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "MAX_RECORDS_IN_RAM=" ; CommandLineBinding:separate false ] ; sld:type xsd:string , sld:null . rdfs:comment "Unpaired single-end read length cutoff needed for read 2 to be written to '.unpaired_2.fq' output file. These reads may be mapped in single-end mode. Default - 35 bp.Last modified on 18 Oct 2012." ; cwl:inputBinding [ CommandLineBinding:prefix "--length_2" ] ; sld:type xsd:string , sld:null . rdfs:comment "Optional adapter sequence to be trimmed off read 2 of paired-end files. This option requires '--paired' to be specified as well." ; cwl:inputBinding [ CommandLineBinding:prefix "--adapter2" ] ; sld:type xsd:string , sld:null . sld:type xsd:string . rdfs:comment "Coverage threshold (in percent) for summarizing statistics" ; cwl:inputBinding [ CommandLineBinding:position 2 ; CommandLineBinding:prefix "--summaryCoverageThreshold" ] ; sld:type sld:null ; sld:type [ sld:items xsd:string ; sld:type sld:array ] . rdfs:comment "Output marked duplicate metrics" ; cwl:outputBinding [ CommandOutputBinding:glob "$(inputs.input.basename.replace('bam', 'md.metrics'))" ] ; cwl:outputBinding [ CommandOutputBinding:glob "$(inputs.input.basename.replace('bam', 'md.metrics'))" ] ; sld:type cwl:File .